# Feedback **URL:** https://forum.eternagame.org/c/feedback/24.md [Latest](https://forum.eternagame.org/latest.md) · [Categories](https://forum.eternagame.org/categories.md) · [Tags](https://forum.eternagame.org/tags.md) --- ## [About the Feedback category](https://forum.eternagame.org/t/about-the-feedback-category/3473)
**Author:** [@LFP6](https://forum.eternagame.org/u/LFP6)\ **Replies:** 0\ **Last updated:** [June 26, 2020, 6:15pm UTC](https://forum.eternagame.org/t/about-the-feedback-category/3473 "2020-06-26T18:15:23Z")
Have an idea or an issue with Eterna? Let the developers know! --- ## [Missing achievements](https://forum.eternagame.org/t/missing-achievements/5834)
**Author:** [@Hearsall](https://forum.eternagame.org/u/Hearsall)\ **Replies:** 1\ **Last updated:** [September 17, 2026, 6:49pm UTC](https://forum.eternagame.org/t/missing-achievements/5834 "2026-09-17T18:49:06Z")
I was surprised to receive a “Designed 200 puzzles” badge yesterday, because the Achievements section of player profiles shows only up to 100, even for players who have made many more puzzles. Shouldn’t the Achievements … --- ## [Better page titles](https://forum.eternagame.org/t/better-page-titles/5825)
**Author:** [@Wipf0](https://forum.eternagame.org/u/Wipf0)\ **Replies:** 0\ **Last updated:** [September 9, 2026, 12:48pm UTC](https://forum.eternagame.org/t/better-page-titles/5825 "2026-09-09T12:48:39Z")
Currently eternagame.org always has the title “Eterna”, no matter where on the page I am. It would be nice to have a dynamic page title with more information. For example on Puzzle 472262 the page title could be Loop nex… --- ## [Error: Unknown character ' ' in parenthesis notation?](https://forum.eternagame.org/t/error-unknown-character-in-parenthesis-notation/5141)
**Author:** [@terraofearth](https://forum.eternagame.org/u/terraofearth)\ **Replies:** 8\ **Last updated:** [September 3, 2026, 1:13pm UTC](https://forum.eternagame.org/t/error-unknown-character-in-parenthesis-notation/5141 "2026-09-03T13:13:22Z")
Hello! This problem might just be on my side, but some puzzles have read “Error: Unknown character ’ ’ in parenthesis notation” when I try to access them. This error appears with a couple of different “unknown characters… --- ## [Number of Puzzles in a Collection Recap on my home page is different than in collection](https://forum.eternagame.org/t/number-of-puzzles-in-a-collection-recap-on-my-home-page-is-different-than-in-collection/5796)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 1\ **Last updated:** [August 4, 2026, 11:03am UTC](https://forum.eternagame.org/t/number-of-puzzles-in-a-collection-recap-on-my-home-page-is-different-than-in-collection/5796 "2026-08-04T11:03:44Z")
Collections are defined by users. So I recognize that the number of puzzles in a collection could change over time. I was exploring the collection titled with 5 question marks (apparently the forum will not allow me to… --- ## [MIssion Accomplished Box shows my points as added to Anonymous, but puzzle was cleared under my account (after I manually logged in to be sure I was logged in)](https://forum.eternagame.org/t/mission-accomplished-box-shows-my-points-as-added-to-anonymous-but-puzzle-was-cleared-under-my-account-after-i-manually-logged-in-to-be-sure-i-was-logged-in/5785)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 5\ **Last updated:** [August 3, 2026, 9:47pm UTC](https://forum.eternagame.org/t/mission-accomplished-box-shows-my-points-as-added-to-anonymous-but-puzzle-was-cleared-under-my-account-after-i-manually-logged-in-to-be-sure-i-was-logged-in/5785 "2026-08-03T21:47:53Z")
I played & solved the new puzzle “Nearly” by Hearsall Eterna . After I solved it the mission accomplished box showed adding +100 points to Anonymous. I copied my sequence to the clipboard. I assumed I was not (still) … --- ## ["Memory Access Out of Bounds" Error in New Lab (RNA Copy Machine - Round 1)](https://forum.eternagame.org/t/memory-access-out-of-bounds-error-in-new-lab-rna-copy-machine-round-1/5795)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 0\ **Last updated:** [August 3, 2026, 3:12pm UTC](https://forum.eternagame.org/t/memory-access-out-of-bounds-error-in-new-lab-rna-copy-machine-round-1/5795 "2026-08-03T15:12:01Z")
After designing for a while (43 changes) in chrome, I get the error following the === line After getting this error, I tried closing and reopening the browser tab, however the error persists when I reopen the tab. The … --- ## [MIssion Accomplished Box Scroll Bar Behavior at different Chrome browser zoom settings](https://forum.eternagame.org/t/mission-accomplished-box-scroll-bar-behavior-at-different-chrome-browser-zoom-settings/5773)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 0\ **Last updated:** [July 8, 2026, 3:01pm UTC](https://forum.eternagame.org/t/mission-accomplished-box-scroll-bar-behavior-at-different-chrome-browser-zoom-settings/5773 "2026-07-08T15:01:55Z")
I was using Chrome with zoom at 100% on puzzle after solving, the Mission accomplished box successfully appeared, but the content was too large to be viewed all at once. A scroll bar was present, but seemed frozen a… --- ## [Contraint calculation issue in OpenKnot Sprint lab?](https://forum.eternagame.org/t/contraint-calculation-issue-in-openknot-sprint-lab/5769)
**Author:** [@Merida](https://forum.eternagame.org/u/Merida)\ **Replies:** 2\ **Last updated:** [July 6, 2026, 3:31am UTC](https://forum.eternagame.org/t/contraint-calculation-issue-in-openknot-sprint-lab/5769 "2026-07-06T03:31:53Z")
Not actually sure if the issue is the calculation, or my understanding of the constraint. Please do correct me if this is not in fact a bug. When trying to design pseudoknots for the current Sprint lab, I noticed what s… --- ## [414 Request-URI Too Large](https://forum.eternagame.org/t/414-request-uri-too-large/5730)
**Author:** [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)\ **Replies:** 4\ **Last updated:** [April 28, 2026, 3:23pm UTC](https://forum.eternagame.org/t/414-request-uri-too-large/5730 "2026-04-28T15:23:13Z")
414 Request-URI Too Large Tried this with Chrome, Edge and Firefox \[LFV\]Folding speed test One of the last comments mentioned using Firefox to bypass errors. Using my new PC for first time so might be a problem h… --- ## [Switch puzzle visual glitch from holding mouse button](https://forum.eternagame.org/t/switch-puzzle-visual-glitch-from-holding-mouse-button/5728)
**Author:** [@ucad](https://forum.eternagame.org/u/ucad)\ **Replies:** 1\ **Last updated:** [April 9, 2026, 7:51pm UTC](https://forum.eternagame.org/t/switch-puzzle-visual-glitch-from-holding-mouse-button/5728 "2026-04-09T19:51:41Z")
Bases can be shown incorrectly in some states of switch puzzles when the mouse button is held down and then redo or undo are used, and a switch between natural and target modes is made before releasing the mouse button. … --- ## [Spamming of collections](https://forum.eternagame.org/t/spamming-of-collections/5068)
**Author:** [@Hearsall](https://forum.eternagame.org/u/Hearsall)\ **Replies:** 8\ **Last updated:** [March 20, 2026, 8:01pm UTC](https://forum.eternagame.org/t/spamming-of-collections/5068 "2026-03-20T20:01:09Z")
In view of recent spamming of the Player Created Collections, I suggest players should have to meet some basic criterion to be able to post a new collection. --- ## [Possible new booster api functions for multi-state puzzles](https://forum.eternagame.org/t/possible-new-booster-api-functions-for-multi-state-puzzles/5674)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 0\ **Last updated:** [December 31, 2025, 3:16am UTC](https://forum.eternagame.org/t/possible-new-booster-api-functions-for-multi-state-puzzles/5674 "2025-12-31T03:16:18Z")
state\_full\_pairing\_probabilities\_async(index=0) for engines that support it, computes the pairing probabilities/dot plot for the state specified by index with the current sequence and oglios, plus any other reagents i… --- ## [EternaScript documentation for set\_tracked\_indices about colouring is incorrect](https://forum.eternagame.org/t/eternascript-documentation-for-set-tracked-indices-about-colouring-is-incorrect/5611)
**Author:** [@Wipf0](https://forum.eternagame.org/u/Wipf0)\ **Replies:** 0\ **Last updated:** [October 18, 2025, 9:58pm UTC](https://forum.eternagame.org/t/eternascript-documentation-for-set-tracked-indices-about-colouring-is-incorrect/5611 "2025-10-18T21:58:58Z")
The EternaScript Documentation describes the marks for set\_tracked\_indices as ‘\[…\] or objects containing a baseIndex and optional color property \[…\]’. However, colouring of the marks is achieved by setting the colors pr… --- ## [A new lab idea](https://forum.eternagame.org/t/a-new-lab-idea/5588)
**Author:** [@ilikebball](https://forum.eternagame.org/u/ilikebball)\ **Replies:** 6\ **Last updated:** [October 7, 2025, 2:23pm UTC](https://forum.eternagame.org/t/a-new-lab-idea/5588 "2025-10-07T14:23:46Z")
We’ve had labs for tuberculosis, covid, ribosomes and even for studying pseudoknots. I was thinking, maybe we could start a new lab that studies the mRNA of cancer cells. Just an idea. Feel free to express your opinions… --- ## [Sequence freezes Ribonanzanet-SS?](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584)
**Author:** [@ucad](https://forum.eternagame.org/u/ucad)\ **Replies:** 3\ **Last updated:** [September 25, 2025, 4:32pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584 "2025-09-25T16:32:27Z")
The length 30 sequences: CCCGGAAAAACCAACCAAAAAAAAAGGGGG CCCGGAAAAACCAAACCAAAAAAAAGGGGG CCCGGAAAAAACCAACCAAAAAAAAGGGGG CCCGGAAAAAACCAAACCAAAAAAAGGGGG CCCGGAAAAAAACCAACCAAAAAAAGGGGG freeze Ribonanzanet-SS for me. I … --- ## [Current view info (mode and switch state) for booster scripts](https://forum.eternagame.org/t/current-view-info-mode-and-switch-state-for-booster-scripts/5578)
**Author:** [@Wipf0](https://forum.eternagame.org/u/Wipf0)\ **Replies:** 2\ **Last updated:** [September 19, 2025, 8:20am UTC](https://forum.eternagame.org/t/current-view-info-mode-and-switch-state-for-booster-scripts/5578 "2025-09-19T08:20:05Z")
I would like to be able to get the currently displayed switch state and mode (natural mode or target mode) from the EternaScript booster API. Here are some mock-ups with the information I would like to be able to get in… --- ## [Null bases replace Adenine?](https://forum.eternagame.org/t/null-bases-replace-adenine/5398)
**Author:** [@calc4me](https://forum.eternagame.org/u/calc4me)\ **Replies:** 0\ **Last updated:** [May 26, 2025, 8:02pm UTC](https://forum.eternagame.org/t/null-bases-replace-adenine/5398 "2025-05-26T20:02:13Z")
I am a somewhat new player to EteRNA, but I know that many bases in a row is unnatural and bad for lab. However, the default base is Adenine, and if I’m like any other players, then I don’t change the loops, and that lea… --- ## [Confidence Delta Minimization](https://forum.eternagame.org/t/confidence-delta-minimization/5347)
**Author:** [@AaronP](https://forum.eternagame.org/u/AaronP)\ **Replies:** 2\ **Last updated:** [April 29, 2025, 5:37am UTC](https://forum.eternagame.org/t/confidence-delta-minimization/5347 "2025-04-29T05:37:08Z")
I’ve been spitballing some puzzle-solving ideas lately and I was told that my idea of natural-target delta minimization of the confidence parameter (RNA SPEC window) might be interesting enough to even warrant a sort of … --- ## [Swap paired bases (5)](https://forum.eternagame.org/t/swap-paired-bases-5/5263)
**Author:** [@ucad](https://forum.eternagame.org/u/ucad)\ **Replies:** 0\ **Last updated:** [February 23, 2025, 2:27am UTC](https://forum.eternagame.org/t/swap-paired-bases-5/5263 "2025-02-23T02:27:43Z")
On the toolbar, change the tooltip text for the swap button from “Swap paired bases” to “Swap paired bases (5)” to include the key binding like the other buttons. --- ## [Visual indicator of unsolved "dont care"/custom target regions](https://forum.eternagame.org/t/visual-indicator-of-unsolved-dont-care-custom-target-regions/5250)
**Author:** [@Eli\_Fisker](https://forum.eternagame.org/u/Eli_Fisker)\ **Replies:** 2\ **Last updated:** [February 11, 2025, 7:57pm UTC](https://forum.eternagame.org/t/visual-indicator-of-unsolved-dont-care-custom-target-regions/5250 "2025-02-11T19:57:30Z")
The game does not recognize unstabilities in the higher order knots, beyond the first order pseudoknot. I have reported on the issue here: Bug in the higher order pseudoknots I think if we are to fully investigate high… --- ## [Cut and paste functionality](https://forum.eternagame.org/t/cut-and-paste-functionality/5229)
**Author:** [@spvincent](https://forum.eternagame.org/u/spvincent)\ **Replies:** 7\ **Last updated:** [February 3, 2025, 2:17am UTC](https://forum.eternagame.org/t/cut-and-paste-functionality/5229 "2025-02-03T02:17:14Z")
What I think would be very useful in design puzzles is a tool that would cut X nucleotides after position Y and insert them after position Z. This can be done right now by using an external text editor but it gets a bit … --- ## [Tool Name Change](https://forum.eternagame.org/t/tool-name-change/5171)
**Author:** [@Jieux](https://forum.eternagame.org/u/Jieux)\ **Replies:** 0\ **Last updated:** [December 20, 2024, 8:37pm UTC](https://forum.eternagame.org/t/tool-name-change/5171 "2024-12-20T20:37:57Z")
The “swap” tool should be immediately renamed the “flip” tool. --- ## [Possible miscalculation of energy in EternaFold](https://forum.eternagame.org/t/possible-miscalculation-of-energy-in-eternafold/5128)
**Author:** [@Hearsall](https://forum.eternagame.org/u/Hearsall)\ **Replies:** 0\ **Last updated:** [October 22, 2024, 5:38pm UTC](https://forum.eternagame.org/t/possible-miscalculation-of-energy-in-eternafold/5128 "2024-10-22T17:38:56Z")
The total free energy of some solutions to EternaFold puzzles seems to be about 0.2 to 0.3 kcal higher than the threshold normally needed for the shape to fold at all. See my comment on \[EFOLD\]Break Test for further expl… --- ## [Cannot currently edit a booster](https://forum.eternagame.org/t/cannot-currently-edit-a-booster/5080)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 5\ **Last updated:** [October 12, 2024, 10:55pm UTC](https://forum.eternagame.org/t/cannot-currently-edit-a-booster/5080 "2024-10-12T22:55:12Z")
When I select Play/Scripts there is no option to create a new script/booster. When a select an existing script/booster there are no option presented to edit it or change its parameters (e.g. favorite/unfavorite). --- ## [Preview: New confidence constraints for RibonanzaNet-SS](https://forum.eternagame.org/t/preview-new-confidence-constraints-for-ribonanzanet-ss/5056)
**Author:** [@LFP6](https://forum.eternagame.org/u/LFP6)\ **Replies:** 9\ **Last updated:** [August 20, 2024, 4:39pm UTC](https://forum.eternagame.org/t/preview-new-confidence-constraints-for-ribonanzanet-ss/5056 "2024-08-20T16:39:45Z")
Hey all! You may remember that when we introduced RibonanzaNet-SS, we also added metrics to the specbox called eF1 and eF1,cross-pair which were presented in the paper as a way to determine how accurate we predict the mo… --- ## [Issues with RibonanzaNet-SS](https://forum.eternagame.org/t/issues-with-ribonanzanet-ss/5018)
**Author:** [@spvincent](https://forum.eternagame.org/u/spvincent)\ **Replies:** 9\ **Last updated:** [August 13, 2024, 4:34pm UTC](https://forum.eternagame.org/t/issues-with-ribonanzanet-ss/5018 "2024-08-13T16:34:11Z")
I’m seeing some odd-looking constructs with this: for example in Pseudoknot 100 in Round 6: SV\_9e Single pair pseudoknot 69/86 Unbonded pairs 7/21 and 66/38 and 32/72 1-nt stem 1/140 along with the barcode forming a p… --- ## [Eternagame.org site will not load](https://forum.eternagame.org/t/eternagame-org-site-will-not-load/5029)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 4\ **Last updated:** [July 24, 2024, 8:07pm UTC](https://forum.eternagame.org/t/eternagame-org-site-will-not-load/5029 "2024-07-24T20:07:44Z")
I cannot seem to load eternagame.org this morning. Is there some ongoing maintenance? --- ## [OpenKnot Round 1 designs not loading](https://forum.eternagame.org/t/openknot-round-1-designs-not-loading/5020)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 8\ **Last updated:** [July 20, 2024, 3:25pm UTC](https://forum.eternagame.org/t/openknot-round-1-designs-not-loading/5020 "2024-07-20T15:25:05Z")
When attempting to load the design browser in round 1, this error message is returned: Error: Invalid parenthesis notation at t.value (https://eternagame.org/eternajs/dist/prod/main.39b8f98588081887cc96.js:2:374454)… --- ## [Preview: RibonanzaNet-SS in Eterna](https://forum.eternagame.org/t/preview-ribonanzanet-ss-in-eterna/4955)
**Author:** [@LFP6](https://forum.eternagame.org/u/LFP6)\ **Replies:** 22\ **Last updated:** [July 17, 2024, 4:46pm UTC](https://forum.eternagame.org/t/preview-ribonanzanet-ss-in-eterna/4955 "2024-07-17T16:46:51Z")
Hey everyone! As a quick recap: Last year, a challenge on the machine learning competition platform Kaggle was launched to use the data from the OpenKnot labs (as well as other sources) to develop new models which could… [Next page](https://forum.eternagame.org/c/feedback/24.md?page=1)