# Feedback **URL:** https://forum.eternagame.org/c/feedback/24.md?page=1 [Latest](https://forum.eternagame.org/latest.md) · [Categories](https://forum.eternagame.org/categories.md) · [Tags](https://forum.eternagame.org/tags.md) **Page:** 2 --- ## [Preview: RibonanzaNet-SS in Eterna](https://forum.eternagame.org/t/preview-ribonanzanet-ss-in-eterna/4955)
**Author:** [@LFP6](https://forum.eternagame.org/u/LFP6)\ **Replies:** 22\ **Last updated:** [July 17, 2024, 4:46pm UTC](https://forum.eternagame.org/t/preview-ribonanzanet-ss-in-eterna/4955 "2024-07-17T16:46:51Z")
Hey everyone! As a quick recap: Last year, a challenge on the machine learning competition platform Kaggle was launched to use the data from the OpenKnot labs (as well as other sources) to develop new models which could… --- ## [Swap tool not activating](https://forum.eternagame.org/t/swap-tool-not-activating/4973)
**Author:** [@bisha](https://forum.eternagame.org/u/bisha)\ **Replies:** 1\ **Last updated:** [June 26, 2024, 2:53pm UTC](https://forum.eternagame.org/t/swap-tool-not-activating/4973 "2024-06-26T14:53:02Z")
I am working on the swap base pairs 2-swapping and the AU zipper technique when I noticed the swap paired bases icon is not activating when I click it. Any insight would be greatly appreciated! --- ## [Base pair probability depiction in Eterna puzzles](https://forum.eternagame.org/t/base-pair-probability-depiction-in-eterna-puzzles/4574)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 7\ **Last updated:** [January 31, 2024, 11:18pm UTC](https://forum.eternagame.org/t/base-pair-probability-depiction-in-eterna-puzzles/4574 "2024-01-31T23:18:11Z")
Jonathan and I were talking about Eternacon on Monday and I pointed out that we really should start talking about transitioning from a nearest neighbor thermodynamics prediction model in the puzzle interface to a base pa… --- ## [Number of Solves](https://forum.eternagame.org/t/number-of-solves/4798)
**Author:** [@JR1](https://forum.eternagame.org/u/JR1)\ **Replies:** 2\ **Last updated:** [January 2, 2024, 5:06pm UTC](https://forum.eternagame.org/t/number-of-solves/4798 "2024-01-02T17:06:12Z")
On the filters: Looks like “solvers” max = 0 isn’t working. Should have selected “Wawanian Garland for Starryjess” but does not. --- ## [Put sequence count on lab review page](https://forum.eternagame.org/t/put-sequence-count-on-lab-review-page/4799)
**Author:** [@ucad](https://forum.eternagame.org/u/ucad)\ **Replies:** 1\ **Last updated:** [January 2, 2024, 5:01pm UTC](https://forum.eternagame.org/t/put-sequence-count-on-lab-review-page/4799 "2024-01-02T17:01:54Z")
On the lab review page include the number of sequences currently shown, probably next to the vote count text at the top. Something like “Showing 1,200 of 250,000 sequences.” (So when there are thousands of sequences you … --- ## [Not receiving email notifications for "News" posts](https://forum.eternagame.org/t/not-receiving-email-notifications-for-news-posts/4690)
**Author:** [@Merida](https://forum.eternagame.org/u/Merida)\ **Replies:** 5\ **Last updated:** [November 18, 2023, 12:38am UTC](https://forum.eternagame.org/t/not-receiving-email-notifications-for-news-posts/4690 "2023-11-18T00:38:10Z")
I noticed today that I am no longer receiving “News” posts in my emails from Eterna. I am still getting emails with the subject line of “Your Eterna Notifications,” but they only contain the comments made in the group I … --- ## [Has there been a change to the game/scripting UI?](https://forum.eternagame.org/t/has-there-been-a-change-to-the-game-scripting-ui/4745)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 6\ **Last updated:** [November 9, 2023, 11:10pm UTC](https://forum.eternagame.org/t/has-there-been-a-change-to-the-game-scripting-ui/4745 "2023-11-09T23:10:53Z")
When I try to fire up the arcknot booster on the latest labs it does not appear to find the “maingame”? --- ## [Support editing comments](https://forum.eternagame.org/t/support-editing-comments/3584)
**Author:** [@ch1ck3n](https://forum.eternagame.org/u/ch1ck3n)\ **Replies:** 1\ **Last updated:** [November 9, 2023, 1:02am UTC](https://forum.eternagame.org/t/support-editing-comments/3584 "2023-11-09T01:02:10Z")
i think it would look prettier if there was a “edit” button. --- ## [Error on mutation in pseudoknot puzzle](https://forum.eternagame.org/t/error-on-mutation-in-pseudoknot-puzzle/4697)
**Author:** [@Creativa](https://forum.eternagame.org/u/Creativa)\ **Replies:** 6\ **Last updated:** [October 19, 2023, 1:32pm UTC](https://forum.eternagame.org/t/error-on-mutation-in-pseudoknot-puzzle/4697 "2023-10-19T13:32:20Z")
Hi. I cannot start a new topic, so I’ll leave this here. I get an error message just by switching a pair. Any suggestions? Error: Pair length doesn’t match sequence length at i.set (https://eternagame.org/eternajs/… --- ## [Openknot Round 4 week 6](https://forum.eternagame.org/t/openknot-round-4-week-6/4722)
**Author:** [@mjt](https://forum.eternagame.org/u/mjt)\ **Replies:** 2\ **Last updated:** [October 9, 2023, 3:42pm UTC](https://forum.eternagame.org/t/openknot-round-4-week-6/4722 "2023-10-09T15:42:47Z")
When I tried to submit a design, the notice, "The length of your sequence is incorrect (seq/lock mismatch). Please contact a developer for assistance. --- ## [Always retain text changes in design submission window](https://forum.eternagame.org/t/always-retain-text-changes-in-design-submission-window/4715)
**Author:** [@ucad](https://forum.eternagame.org/u/ucad)\ **Replies:** 0\ **Last updated:** [September 28, 2023, 8:32pm UTC](https://forum.eternagame.org/t/always-retain-text-changes-in-design-submission-window/4715 "2023-09-28T20:32:52Z")
When submitting a lab design, clicking “cancel” closes the window and any text field changes are there the next time you go to submit. Clicking outside the submission window closes the window and clears any text field c… --- ## [Script Error on puzzle](https://forum.eternagame.org/t/script-error-on-puzzle/4395)
**Author:** [@TheInverted](https://forum.eternagame.org/u/TheInverted)\ **Replies:** 3\ **Last updated:** [December 7, 2022, 5:50pm UTC](https://forum.eternagame.org/t/script-error-on-puzzle/4395 "2022-12-07T17:50:48Z")
Hello, I recently made a new two state switch called “Fabric of the Cosmos.” Here is the link Eterna. The issue is that everytime I open the puzzle I get at least two messages saying “script error” before I am actually … --- ## [Request for testing: 2023 API rewrite](https://forum.eternagame.org/t/request-for-testing-2023-api-rewrite/4670)
**Author:** [@LFP6](https://forum.eternagame.org/u/LFP6)\ **Replies:** 21\ **Last updated:** [September 13, 2023, 5:49pm UTC](https://forum.eternagame.org/t/request-for-testing-2023-api-rewrite/4670 "2023-09-13T17:49:02Z")
Hey all ! I have a very large change that would love some help in testing out. Over the past few months, I’ve completely rewritten the backend API of our website (ie, the bit that stores data whenever you take an action… --- ## [News only loading most recent](https://forum.eternagame.org/t/news-only-loading-most-recent/4683)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 1\ **Last updated:** [September 8, 2023, 5:22pm UTC](https://forum.eternagame.org/t/news-only-loading-most-recent/4683 "2023-09-08T17:22:18Z")
News alerts prior to February-May of this year not loading while page appears to attempt to load all alerts at once. Sometimes when searching News, results are not sequential by date. Are results weighted now? Try searc… --- ## [Player profile - Achievements page](https://forum.eternagame.org/t/player-profile-achievements-page/4685)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 1\ **Last updated:** [September 8, 2023, 5:21pm UTC](https://forum.eternagame.org/t/player-profile-achievements-page/4685 "2023-09-08T17:21:15Z")
Achievements page displays my achievements rather than the player’s achievements. Let me know if you can’t reproduce and need screenshot. --- ## [Searching for puzzles by Player returns puzzles by other players](https://forum.eternagame.org/t/searching-for-puzzles-by-player-returns-puzzles-by-other-players/4684)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 2\ **Last updated:** [September 8, 2023, 3:35pm UTC](https://forum.eternagame.org/t/searching-for-puzzles-by-player-returns-puzzles-by-other-players/4684 "2023-09-08T15:35:45Z")
Test case Goto Play Puzzles IN the “Search Users” box, type enough of Astromon that his Image + his UserName pops up below the box. Click on the image + his UserName. –page displayed is “Eterna” and that page shows 18… --- ## [Wrong scores on 30-day leaderboard](https://forum.eternagame.org/t/wrong-scores-on-30-day-leaderboard/4679)
**Author:** [@Hearsall](https://forum.eternagame.org/u/Hearsall)\ **Replies:** 4\ **Last updated:** [September 6, 2023, 8:06am UTC](https://forum.eternagame.org/t/wrong-scores-on-30-day-leaderboard/4679 "2023-09-06T08:06:10Z")
Starting yesterday, the 30-day leaderboard is showing what appear to be 60-day scores instead of 30-day scores. --- ## [Unable to upload PDB file](https://forum.eternagame.org/t/unable-to-upload-pdb-file/4678)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 1\ **Last updated:** [August 31, 2023, 4:56pm UTC](https://forum.eternagame.org/t/unable-to-upload-pdb-file/4678 "2023-08-31T16:56:16Z")
Got this error message when attempting to upload PDB file 6XRZ (a Das Lab contribution) in drupal. I’ve never received an error message when uploading a 3D file previously. Typically the system lets me upload the file th… --- ## [Target Mode doesn't show pseudoknot](https://forum.eternagame.org/t/target-mode-doesnt-show-pseudoknot/4677)
**Author:** [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)\ **Replies:** 1\ **Last updated:** [August 31, 2023, 12:49am UTC](https://forum.eternagame.org/t/target-mode-doesnt-show-pseudoknot/4677 "2023-08-31T00:49:35Z")
I noticed while browsing solutions to an EFTK player puzzle that the browser doesn’t show the pseudoknot in target mode. The pseudoknot shows up in natural mode though. --- ## [Eternacon videos](https://forum.eternagame.org/t/eternacon-videos/4672)
**Author:** [@spvincent](https://forum.eternagame.org/u/spvincent)\ **Replies:** 1\ **Last updated:** [August 25, 2023, 6:52pm UTC](https://forum.eternagame.org/t/eternacon-videos/4672 "2023-08-25T18:52:35Z")
Thanks for putting these up. However I believe the video of Catherine Eichorns presentation is in there twice: once where it should be and again under Jonathan Romanos presentation. --- ## [Collection tag](https://forum.eternagame.org/t/collection-tag/4627)
**Author:** [@JR1](https://forum.eternagame.org/u/JR1)\ **Replies:** 0\ **Last updated:** [July 15, 2023, 1:45am UTC](https://forum.eternagame.org/t/collection-tag/4627 "2023-07-15T01:45:32Z")
Under puzzle info you might add a new green tag to point to a specific collection. Might make collections used more. --- ## [New error in javascript console](https://forum.eternagame.org/t/new-error-in-javascript-console/4601)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 3\ **Last updated:** [June 6, 2023, 10:54pm UTC](https://forum.eternagame.org/t/new-error-in-javascript-console/4601 "2023-06-06T22:54:26Z")
DevTools failed to load source map: Could not load content for Eterna Unexpected token ‘\<’, "\ **Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 3\ **Last updated:** [June 6, 2023, 5:33am UTC](https://forum.eternagame.org/t/cannot-select-all-in-new-script-editor/4600 "2023-06-06T05:33:18Z") For various reasons I’ve found it useful to do a “Select All” (ctrl-A ctrl-C or cmd-A cmd-C) on the text in the script editor to save an offline versioned copy of my scripts when they start to get over a few hundred line… --- ## [New search tabs](https://forum.eternagame.org/t/new-search-tabs/4587)
**Author:** [@JR1](https://forum.eternagame.org/u/JR1)\ **Replies:** 2\ **Last updated:** [June 5, 2023, 5:27pm UTC](https://forum.eternagame.org/t/new-search-tabs/4587 "2023-06-05T17:27:19Z")
Looks good. @ items you might address. When I first go into play/puzzles the green check marks are not showing up for puzzles solved since upgrade. When you use the search, they then show up. Next: after solving a puzz… --- ## [Can other engines such as LinearFold generate pairing probabilities data?](https://forum.eternagame.org/t/can-other-engines-such-as-linearfold-generate-pairing-probabilities-data/3097)
**Author:** [@jandersonlee](https://forum.eternagame.org/u/jandersonlee)\ **Replies:** 13\ **Last updated:** [May 19, 2023, 2:11am UTC](https://forum.eternagame.org/t/can-other-engines-such-as-linearfold-generate-pairing-probabilities-data/3097 "2023-05-19T02:11:01Z")
Currently, arcplot only works with the ViennaRNA-2.4.9 energy model (and only for small to medium sized single-state puzzles or 2-state switches). If other folding engines can (1) generate pairing-probabilities data, and… --- ## [Puzzlemaker](https://forum.eternagame.org/t/puzzlemaker/3086)
**Author:** [@lroppy](https://forum.eternagame.org/u/lroppy)\ **Replies:** 5\ **Last updated:** [May 9, 2023, 4:59am UTC](https://forum.eternagame.org/t/puzzlemaker/3086 "2023-05-09T04:59:34Z")
Within reason, commands should function the same in puzzles and in puzzlemaker. The following eterna hotkeys available in puzzles are not available in puzzlemaker (N, G, R, and \[comma\]). Work-around: The functionalit… --- ## [Pseudoknot 90 lab ‎“fatal error : pair length does not match sequence length”](https://forum.eternagame.org/t/pseudoknot-90-lab-fatal-error-pair-length-does-not-match-sequence-length/4342)
**Author:** [@OSC](https://forum.eternagame.org/u/OSC)\ **Replies:** 2\ **Last updated:** [May 9, 2023, 12:00am UTC](https://forum.eternagame.org/t/pseudoknot-90-lab-fatal-error-pair-length-does-not-match-sequence-length/4342 "2023-05-09T00:00:41Z")
i ve got this error while regular playing (not with any copy-paste seq) -only when trying to switch natural mode SEQ: GGGAACGACUCGAGUAGAGUCGAAAAGCGCGCAGGGCCGGGCGCGCGGGUACCACGCGCGCCAGUCAGGCGCGACUGACUGAAAAAAAUGGUACCAUUA… --- ## [Base graphics update](https://forum.eternagame.org/t/base-graphics-update/4497)
**Author:** [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)\ **Replies:** 42\ **Last updated:** [March 30, 2023, 1:33am UTC](https://forum.eternagame.org/t/base-graphics-update/4497 "2023-03-30T01:33:15Z")
The developers have devised a new color scheme for the puzzle bases to make the blue and green bases easier to distinguish, but more importantly easier for folks with color blindness to differentiate. The new color schem… --- ## [Pseudoknot score](https://forum.eternagame.org/t/pseudoknot-score/4370)
**Author:** [@JR1](https://forum.eternagame.org/u/JR1)\ **Replies:** 1\ **Last updated:** [March 11, 2023, 3:13pm UTC](https://forum.eternagame.org/t/pseudoknot-score/4370 "2023-03-11T15:13:31Z")
The dev’s might think about creating a single score from the Pair Probability Plot to show when the pseudoknot(s) are sufficiently balanced with the stacks to score well. Solving a pseudoknot puzzle is pretty easy but b… --- ## ["Fatal Error" when loading puzzles (Did I break it?)](https://forum.eternagame.org/t/fatal-error-when-loading-puzzles-did-i-break-it/4462)
**Author:** [@Merida](https://forum.eternagame.org/u/Merida)\ **Replies:** 4\ **Last updated:** [February 9, 2023, 4:39am UTC](https://forum.eternagame.org/t/fatal-error-when-loading-puzzles-did-i-break-it/4462 "2023-02-09T04:39:02Z")
I loaded and solved a few puzzles this evening without any issues, but after reading one of the recent news updates posted, I went into the “Just for fun” collection and tried to open this puzzle https://eternagame.org/g… [Previous page](https://forum.eternagame.org/c/feedback/24.md) [Next page](https://forum.eternagame.org/c/feedback/24.md?page=2)