Add more RNAfold output details for lab designs?

Feedback Feature Suggestions
1

One concept I feel needs more attention are the possibility of sub-optimal folds in submitted designs, which is one of the major reasons one would avoid an all GC sequence. There are some easy way to start players thinking about this when they submit designs just by having access to additional output from the viennaRNA backend. Currently, only MFE (minimum free energy) and the melting temp are displayed, but the RNAfold program also outputs the frequency of the MFE in the ensemble and the ensemble diversity, both of which would provide immediate feedback if a submitted design is only marginally more stable than many other possible folds.

Ideally, users would have access to output from the subopt program as well, which actually enumerates the suboptimal folds, but I realize that may be too ambitious a feature to add.

MFE frequency and ensemble diversity, however, should already be available “for free” somewhere in the backend.

Here is an example output from a run on the viennaRNA RNAfold server:

http://rna.tbi.univie.ac.at/cgi-bin/R…

Additionally, the related RNAeval program provides a very nice breakdown of the energy terms for a design, which would provide another valuable, quantitative way for lab voters to compare the merits of different designs . . .

example output from the same sequence in the above link:

External loop : -160

Interior loop ( 3, 18) CG; ( 4, 17) GC: -240

Interior loop ( 4, 17) GC; ( 5, 16) CG: -340

Interior loop ( 5, 16) CG; ( 6, 15) GC: -240

Interior loop ( 6, 15) GC; ( 7, 14) GC: -330

Hairpin loop ( 7, 14) GC : 490

GGCGCGGCACCGUCCGCGGAACAAACGG

…(((((…)))))… ( -8.20)

2

Dear Alan.robot – this is a wonderful idea, and it is certainly not too ambitious to have in the program. In fact, we use the ViennaFold suite as our engine, and have already experimented with presenting these and other features.

Good timing – the devs just finished a meeting where we independently decided that adding these features (including a way to visualize alternative structures in so-called ‘dot plots’) is critical for players! Its high priority, just after improvements to the voting/selection procedure (which might take a couple weeks).

Thanks for going beyond the call of duty here. And please keep posting ideas – especially ambitious ones! – as well as feedback on the new features when they get implemented.

3

Really just making the dot plot view better would be an excellent start. Thanks alan!

4

Hi Chris - added that to the task list. It’s now task #429 - thanks for reporting!