Does the lab check to see if a submission is an exact duplicate of another already submitted? If not should they, and how to award credit–1st comer gets all or some kind of split? Maybe we should have a design/spell checker feature as a tool?
There is a check to make sure identical designs cannot be submitted in the lab.
If you try to submit the following sequence in the hand and finger switch lab
GGAAAGUAAGCAAUGUAGACAGGAUAUCUUGAUAACCUUCAAGAGAAGGGUCACAAGAACUACUGUUCAGUUUGCAAAGAAACAACAACAACAAC
An error message should pop up saying “Design HAFB 1 already used this sequence in the current round, failed”
You can also try this next sequence in the Sea turtle lab, and an error message should pop up as well.
GGAAAGACCUGCAUCAAAGAUGAACAGAGUCAACUGAAGUGACAGAGUGGCAGAACUCAAAGAGCUGGCACCUGCACCAGAAAGAAACAACAACAACAAC
Thanks,
that takes the worry out of doing countless modifications of others’ solutions and wondering if they have already been submitted. If the lab accepts it then it should be a new unknown solution or modification.