Naturally Occurring RNA Shapes for CloudBeta

1

I thought it might be fun to try some naturally occurring RNA shapes in CloudBeta.
Here are some shapes reportedly found in nature, some of which could be worth trying:

.(.((.((…(((…(((…(((…)))…)))…)).)…)).)).)…
.((((…(((…(…(.(((…(…)…))).)…)…)))))))…
.((((.(…(((…(…(…)…)…)))…).)))).
.((((.((…(((…(((…((…))…)))…)).)…)).))))…
.((((.((…(((…(((…(((…)))…)))…)).)…)).))))…
.((((.((…(((.((…)).))(((…).(((…))))))…)).))))…
.((((.(((…(.(…).)…)))…(…).))))…
.((((.(((…(.(…).)…)))…(…((…)).).))))…
.((((.(((…((…))…)))…(…)…))))…
.((((.(((…((…))…)))…(…).))))…
.((((.(((…(((…)))…)))…(…)…))))…
.((((.(((…(((…)))…)))…(…((…))).))))…
.(((((…(.(…(((…)))…).)…)))))…
.(((((…(((…)))…(…)…)))))…
.(((((…(.((…(((…(.(…).)…)))…)).).)))))…
.(((((…(…(((…)))…).(…)…((…))…)))))…
.(((((…((…((…))…)).(…)…((…))…)))))…
.(((((…((…(((…)))…))…(…((…)).).)))))…
.(((((…((((((.((…)).)))…))).(((((…)))))…)))))…
.(((((.(…((…))…)(…)…(…)…)))))…
.(((((.(…(…((.(((…(…)…))).))…)…))))))…
.(((((.(…((.(…).))(((…).((…)).))…).)))))…
.(((((.(…(…((.((…)).))…)…).)))))…
.(((((.(…(((.(…(((…)))…).)))…).)))))
.(((((.((…((…))…))(…)…(…)…)))))…
.(((((.((…((…))…))(…)…(((…)))…)))))…
.(((((.((…(((…)))…))(…)…)))))…
.(((((.((…(((…))).))…(…)…)))))…
.(((((.(((…((…))…)))…((…))…)))))…
.(((((.(((…((…))…)))(…)…(…)…)))))…
.(((((.(((…((…))…)))(…)…((…))…)))))…
.(((((.(((…((…))…)))(…)…((…))…)))))…
.(((((.(((…(((…)))…)))…(…(((…)))).)))))…
.(((((.(((…(((…)))…)))(…)…(…)…)))))…
.(((((.(((…(((…)))…)))(…)…((…))…)))))…
.(((((.(((…(((…)))…)))(…)…(.(…).)…)))))…
.((((((…(…((…))…).(…)…(…)…))))))…
.((((((.((…((…))…))(…)…((…))…))))))…
.((((((.(((…((…))…)))(…)…(…)…))))))…
.((((((.(((…(((…)))…)))(…)…(…)…))))))…
.(((((((…(.(…(…(.((…)).)…)…).)…)))))))…
.(((((((…(.(…(((…(((…)))…)))…)…)…)))))))…
.(((((((((.(((…(.(.((…((…))…)).).)…))).)))))))))…

2

@jandersonlee, if some of these end up in the next round of labs, can you make sure that the ‘natural’ RNA sequence gets submitted?

3

Interestingly enough, the purported “natural” sequence frequently does not conform to the EteRNA model rules and hence would not be allowed to be submitted. :slight_smile:

5

Or rather, for the “natural” sequences, the purported shape often is not the one that the EteRNA model would predict.

7

Case in point:

id: 2o45

seq: AAGUCGCAUCCUGGGGCUGAAGAAGGUCCCAAGGGUUGGGCUGUUCGCCCAUUAAAGCGGCAA

shape: …(((((…((((((.((…)).)))…))).(((((…)))))…)))))…

Although the leading and trailing AA/… are added to pad to 63 bases, they are not the problem. The U-G at 12-33 is not predicted to be sufficient to close the 0-2 bulge and the G-U at 16-27 is predicted to bond, closing the 1-1 bulge.

But many other sequences are predicted to form the target shape.

8

That’s a great point. I’ll talk to the devs about loosening the constraint for submitted designs… [we could instead just have a ‘warning’ to the player who is submitting].