# Please review the proposed puzzles for the initial OpenCRISPR round
**URL:** https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861
**Category:** Uncategorized
**Created:** [August 14, 2017, 11:25pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861 "2017-08-14T23:25:00Z")
**Posts on this page:** 20
**Page:** 2
### Author:  [@Omei](https://forum.eternagame.org/u/Omei)
#### Post date: [August 15, 2017, 7:09pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/33 "2017-08-15T19:09:00Z")
Right. Are you OK with it by switching between modes as needed?
---
### Author:  [@Astromon](https://forum.eternagame.org/u/Astromon)
#### Post date: [August 15, 2017, 7:20pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/34 "2017-08-15T19:20:00Z")
FMN 1a-on- GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAGAGGAUAUAAAGUAAAAUAAAAUAAAACAUGAGGAUCACCCAUGUACAACAUGAGGAUCACCCAUGUCACCCUUAGAAGGUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU -vienna1
TEP-1-a-on- GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUGAUACCAGUGAAUAAUAAUAACAUGAGGAUCACCCAUGUCAUGUAAUAAAAUAAAUAAAAUAAAAUAACGCCCUUGGCAGCAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU -vienna1
Tep-1-a-on-venna2- GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUGAUACCAGUGAAUAAUAAUUACAUGAGGAUCACCCAUGUCAUGGAAUAAAAUAAAUAGUCUAAGAUAACGCCCUUGGCAGCAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@Omei](https://forum.eternagame.org/u/Omei)
#### Post date: [August 15, 2017, 7:24pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/35 "2017-08-15T19:24:00Z")
OK, I have a spreadsheet for keeping track of what has and hasn’t been solved - [https://docs.google.com/spreadsheets/d/1DLUBU4LssU4HWyyFLqUi\_LpfFyl8XP95W2xYUKQ-gps/edit?usp=sharing](https://docs.google.com/spreadsheets/d/1DLUBU4LssU4HWyyFLqUi_LpfFyl8XP95W2xYUKQ-gps/edit?usp=sharing "Link https//docsgooglecom/spreadsheets/d/1DLUBU4LssU4HWyyFLqUi\_LpfFyl8XP95W2xYUKQ-gps/edituspsharing"). You can consult it if you want to see which puzzles haven’t had any solutions submitted, or just to make sure that I have recorded your own. Feel free to leave comments in the spreadsheet if you see something in the spreadsheet that doesn’t seem right.
Thanks for all the quick responses!
---
### Author:  [@Eli\_Fisker](https://forum.eternagame.org/u/Eli_Fisker)
#### Post date: [August 15, 2017, 7:48pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/37 "2017-08-15T19:48:00Z")
**CRISPR/Cas9 - Tetracycline - ON**
It can be solved in blueprint style.
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCUCAAUAAAUAAAACAUGAGGAUCACCCAUGUAAAAUAAUAAGAAAGGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
[http://www.eternagame.org/game/puzzle/8040919/](http://www.eternagame.org/game/puzzle/8040919/ "Link http//wwweternagameorg/game/puzzle/8040919/")
**CRISPR/Cas9 - Tetracycline - OFF**
Also the partnering lab can be solved in blueprint style
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCACAUGAGGAUCACCCAUGUAAUAAAGAAAGGUGAUUACAAAAUAAAGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@whbob](https://forum.eternagame.org/u/whbob)
#### Post date: [August 15, 2017, 8:08pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/39 "2017-08-15T20:08:00Z")
Yes, a nice challenge.
---
### Author:  [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)
#### Post date: [August 15, 2017, 8:20pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/40 "2017-08-15T20:20:00Z")
**FMN 1b - ON**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAAGAAGGUACAAAACAUGAGGAUCACCCAUGUAAUAGUAGAGUUAUGAAUUCAUAGCUCUAUAAGUUACAUAGUGAGGAUAUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Seems to have a lot of potential variability.
**FMN 1b - OFF**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAGAAGGUAUAUAUUAAUUCUUAAGAUGUAGACUGUCUAUUGAUAGUCUACAUCAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Again, appears to have a lot of potential variability.
**_Puzzle appears to be unsolvable in NuPACK, all in the locked portion._**
---
### Author:  [@Eli\_Fisker](https://forum.eternagame.org/u/Eli_Fisker)
#### Post date: [August 15, 2017, 8:26pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/42 "2017-08-15T20:26:00Z")
**CRISPR/Cas9 - FMN 2 - ON**
Ugly solve, not much blueprint here
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACCCAAAUAUAAAAUAAAAUAAAUCCUAAGAAGGAUAUCCGGAAACGGAGAAGGUCUCCUAGUAAAACAUGAGGAUCACCCAUGUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
[http://www.eternagame.org/game/puzzle/8038693/](http://www.eternagame.org/game/puzzle/8038693/ "Link: http://www.eternagame.org/game/puzzle/8038693/")
**CRISPR/Cas9 - FMN 2 - OFF**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACCCAAAAUAUAACAUGAGGAUCACCCAUGUAGGAUAUAGGAAAACCUAGAAGGACAAAACCUCAGACAAAAGUCUGAGGAAAGGGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
[http://www.eternagame.org/game/puzzle/8047738/](http://www.eternagame.org/game/puzzle/8047738/ "Link: http://www.eternagame.org/game/puzzle/8047738/")
---
### Author:  [@Astromon](https://forum.eternagame.org/u/Astromon)
#### Post date: [August 15, 2017, 8:34pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/44 "2017-08-15T20:34:00Z")
I too have noticed in Nupak the locked bases forming a structure breaks apart.
I was able to get designs with both vienna, and vienna2. Thanks
---
### Author:  [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)
#### Post date: [August 15, 2017, 9:33pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/45 "2017-08-15T21:33:00Z")
**FMN 2 - ON**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUGUCAAACAUGAGGAUCACCCAUGUAAAGAAGGAUAUGAGUAUUCUCAGAAGGUCUUCAUGUUAUUUAUUUAUAUUAUUUAGACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to be plenty of potential variability.
**FMN 2 - OFF**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUCGCAUUUAUAACAUGAGGAUCACCCAUGUAGGAUAUGCGUAUUCGCAGAAGGAUAUGGAAGUAGACUGAUUCAGUCUACAGCGAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to be plenty of potential variability.
---
### Author:  [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)
#### Post date: [August 15, 2017, 10:49pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/46 "2017-08-15T22:49:00Z")
**FMN 3 - ON**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAACAUGAGGAUAUGUGUAUUCACAGAAGGUAUAAGAUGAUGUAUUCAUCAUCAAUACAUGAGGAUCACCCAUGUUUUAUGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to have plenty of variability.
**_Appears to be unsolvable with NuPACK, again the static locked bottom portion._**
**FMN 3 - OFF**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUCAAAUGUAGGAUAUCUGUAUUCAGAGAAGGACAUGAGGAUCACCCAUGUAAGACUAGAGAUGAUUCAUCUCUAGUCAAAUGAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
This puzzle seemed just a bit more difficult than the rest of the FMN series. **_Again with the state 2 not solvable with NuPACK._** Seems to have a lot of potential variability.
---
### Author:  [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)
#### Post date: [August 15, 2017, 11:47pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/47 "2017-08-15T23:47:00Z")
**FMN 4 - ON**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAGAGGUUGCUCAACAUGAGGAUCACCCAUGUAGGAAAGCCUUAGGCAUCAAGGAUAUUGUUCCUACAAGAAGGUGAAUAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Ugly solution.
**FMN 4 - OFF**
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAAGAUGAUCGAGACUAUUGUCUCGAUCAUCAACAUGAGGAUCACCCAUGUAGGAUAUCUCUAUUGAGAGAAGGACAUAAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@Omei](https://forum.eternagame.org/u/Omei)
#### Post date: [August 16, 2017, 12:17am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/48 "2017-08-16T00:17:00Z")
Thank you, @AndrewKae, for bringing up the issue with NUPACK predicting that the oligo will fall off. I’m going to bring up this up with the devs that designed the puzzles, but let me explain why it might be left just as it is.
In a real CRISPR system, what appears in the puzzle as an RNA oligo is actually a segment of genetic DNA. Base sequences 1-20 in the puzzle represent the CRISPR single stranded “guide” RNA strand that binds to the the DNA, which is what allows CRISPR to latch onto a specific segment of DNA. For the CRISPR mechanism to be effective, the guide RNA can’t be binding to some other part of the CRISPR mechanism (which includes our switching portion our designs) in preference to the DNA oligo. So falling off of the DNA is a real phenomenon that has to be taken into account.
What I don’t know, though, is whether the specific DNA segment in the puzzles was carefully chosen so that the guide sequence had a pretty strong tendency to pair with the other locked CRISPR bases, to ensure that this issue could and would show up in the in silico puzzles. I certainly suspect it was chosen with that in mind.
I also suspect that the puzzles can be solved, even in NUPACK, but that it may require starting over with a fresh approach. So if you’ve for the energy for it, keep trying. Meanwhile, I’ll talk with the devs and get back to you.
---
### Author:  [@AndrewKae](https://forum.eternagame.org/u/AndrewKae)
#### Post date: [August 16, 2017, 12:30am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/50 "2017-08-16T00:30:00Z")
Thanks for the explanation Omei. If you find solutions for the ones I mentioned please let me know.
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 9:57am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/51 "2017-08-16T09:57:00Z")
**TEP 3 ON** :
easily solved (ugly solve), not sure about further analysis
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAACACAAUGAUACCAGAGAAACCACUCCCUUGGCAGCAUAAACAUGAGGAUCACCCAUGUAAACAUGGAAAUAACACAACACAAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 10:12am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/52 "2017-08-16T10:12:00Z")
**TEP 3 OFF** :
again, easily solved (ugly solve), not sure about further specs
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAACCAAAGUGAUACCAGAGUAAUAACUCCCUUGGCAGCACAUGAGGAUCACCCAUGUAAAUUUAUUUAAUUCUAACAAAACAACAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 10:23am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/55 "2017-08-16T10:23:00Z")
Vienna btw
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 10:23am UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/56 "2017-08-16T10:23:00Z")
Vienna btw
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 2:53pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/57 "2017-08-16T14:53:00Z")
**TEP 4 ON**
one of the requirements is “at most 4 A’s in a row”, the sequence below gives all green (= a solve) but between bases 155 and 160 there are 5 A’s in a row… Is this allowed because they are locked ? Or am I missing something else (newbie…)? Same for TEP 4 OFF…
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAACAACAACUCACAUGAGGAUCACCCAUGUUACAGGGAACACACAACGAUACCAGAAACACAAUUCCCUUGGCAGCGUAGAACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@yulan](https://forum.eternagame.org/u/yulan)
#### Post date: [August 16, 2017, 3:08pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/58 "2017-08-16T15:08:00Z")
And for completeness’ sake:
**TEP 4 OFF** :
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAACAAAACUAAACAUGAGGAUCACCCAUGUUAGAGGGAAACAACAACGAUACCAGAAACACAAUUCCCUUGGCAGCGUAGAACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
---
### Author:  [@Omei](https://forum.eternagame.org/u/Omei)
#### Post date: [August 16, 2017, 6:40pm UTC](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861/59 "2017-08-16T18:40:00Z")
Thank you, everyone. I think we have at least one solve for all the puzzles.
The major concern that has surfaced is that some puzzles seem difficult, or perhaps impossible, to solve for NUPACK. This is a concern, and we would like to get more information about how extensive this is before making a final decision on the puzzzles.
I’m going to add a new column to the spreadsheet to record solvability in NUPACK. Could you now specifically try for NUPACK solutions, posting either successful designs or unexpected inability to come up with one?
[Previous page](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861.md?page=1)
[Next page](https://forum.eternagame.org/t/please-review-the-proposed-puzzles-for-the-initial-opencrispr-round/2861.md?page=3)