# Sequence freezes Ribonanzanet-SS?
**URL:** https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584
**Category:** Bug Reports
**Tags:** issue-in-progress
**Created:** [September 20, 2025, 7:56pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584 "2025-09-20T19:56:18Z")
**Posts on this page:** 4
**Page:** 1
### Author:  [@ucad](https://forum.eternagame.org/u/ucad)
#### Post date: [September 20, 2025, 7:56pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584/1 "2025-09-20T19:56:18Z")
The length 30 sequences:
CCCGGAAAAACCAACCAAAAAAAAAGGGGG
CCCGGAAAAACCAAACCAAAAAAAAGGGGG
CCCGGAAAAAACCAACCAAAAAAAAGGGGG
CCCGGAAAAAACCAAACCAAAAAAAGGGGG
CCCGGAAAAAAACCAACCAAAAAAAGGGGG
freeze Ribonanzanet-SS for me.
I was solving the puzzle [[RNET] Small and Easy 6](https://eternagame.org/puzzles/14025706/play) when I tried the first sequence.
The Page Unresponsive freeze happens both in the puzzle and the puzzle maker, both in Chrome and Microsoft Edge. Changing the puzzle maker structure doesn’t stop the error. Experimented and found the 2nd sequence. Changing the sequence length or engine removes the error. (edit: Added 3 more sequences.)
---
### Author:  [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)
#### Post date: [September 20, 2025, 9:45pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584/2 "2025-09-20T21:45:05Z")
Can confirm behavior after testing. Thanks for reporting.
---
### Author:  [@arosko](https://forum.eternagame.org/u/arosko)
#### Post date: [September 22, 2025, 10:06pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584/3 "2025-09-22T22:06:03Z")
That’s really interesting. I wouldn’t expect a neural network to freeze or not freeze depending on the input (aside from possibly an out-of-memory error if the LENGTH of the input is too long), internally it’s just a series of multiplications and thresholds basically. It can return a wrong and/or very low confidence result but input-dependent crashing and/or freezing is hard to rationalize. Maybe someone with direct access to the code that runs the model can determine if the crash happens inside RibonanzaNet itself or in the conversion of the output to dot-bracket.
---
### Author:  [@LFP6](https://forum.eternagame.org/u/LFP6)
#### Post date: [September 25, 2025, 4:32pm UTC](https://forum.eternagame.org/t/sequence-freezes-ribonanzanet-ss/5584/4 "2025-09-25T16:32:27Z")
Thanks for the report. The issue is essentially a typo causing an infinite loop when resolving conflicts between multiple candidate basepairs in the game’s implementation of the hungarian algorithm. I have a fix which I aim to release soon - hopefully next week