# What is the best coronavirus vaccine or therapeutic to Eternalize?
**URL:** https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140
**Category:** Uncategorized
**Created:** [March 21, 2020, 2:11pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140 "2020-03-21T14:11:00Z")
**Posts on this page:** 12
**Page:** 4
### Author:  [@eternacac](https://forum.eternagame.org/u/eternacac)
#### Post date: [April 5, 2020, 12:01pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/79 "2020-04-05T12:01:00Z")
ACE2 work and Spike protein insert work, different format:
All run through SwissTargetPrediction website.
Need compliment to these ACE2 binding pockets:
Baicalin site NRH, asn-arg-his, AAU\_AGA\_CAU –\>
UUA\_UCU\_GUA —\> compliment LSV
Scutellarin site E-(unk)-R glu-unk-arg (don’t know what to do here)
Hesperetin site YSRE, tyr-ser-arg-glu,
UAU\_UCU\_CGU\_GAA–\> AUA\_AGA\_GCA\_CUU —\>
compliment IRAL
Nicotianamine site RESQQ, arg-glu-ser-gln-gln,
AGA\_GAA\_UCA\_CAA\_CAG–\>
UCU\_CUU\_AGU\_GUU\_GUC—\> compliment SLSVV
## Glycyrrhizin site RQRD, arg-gln-arg-asp, AGA\_CAA\_AGG\_GAU–\> UCU\_GUU\_UCC\_CUA—\> compliment SVSL
ACE2 receptor activity?
in C-terminus found: VSL (5’-3’)?, NVSL or VSLV, Glycyrrhizin
site (RQRD) compliment (SVSL). This is also reverse read of
Bailcalin site (NRH) compliment (LSV).
VSL:smiles:CC(C)C[C@H](NC(=O)C@HNC(=O)[C@@H]
(N)C(C)C)C(O)=O [PTGS2 & HLA-A3 hits]
NVSL:smiles:CC(C)C[C@H](NC(=O)C@HNC(=O)
C@@HC(C)C)C(O)=O
VSLV:smiles:CC(C)C[C@H](NC(=O)C@HNC(=O)
C@@HC(C)C)C(=O)NC@@HC(O)=O
[antigen hit]
SVSL:smiles:CC(C)C[C@H](NC(=O)C@HNC(=O)
C@@HC(C)C)C(O)=O [PTSG2 &
antigen hit]
SLSVV:smiles:CC(C)CC@HC(=O)N
C@@HC(=O)NC@@HC(=O)NC@@H
C(O)=O [HLA-A3 top hit, DLG4, DPP4,etc]
SLSV:smiles:CC(C)CC@HC(=O)N
C@@HC(=O)NC@@HC(O)=O [much better hits]
LSVV:smiles:CC(C)CC@HC(=O)NC@@HC(=O)N
C@@HC(=O)NC@@HC(O)=O [not as good]
LSV:smiles:[H]NC@@HC(=O)NC@@HC(=O)
NC@@HC(O)=O [ok hits bit weak]
* * *
Spike Protein LRGAAPASHR (??my error??)
CCUCGGCGGGCA = PRRA insertion in Spike Protein
[hits NTSR1/2, FURIN, WDR5, F10, HGFAC, CFB, …, PLG]
PRRA compliment = GGA\_GCC\_GCC\_CGU = GAAP
[strong hit ACE, DPP4, CAPN1, SLC5A, XIAP, HLA-A3, PTGS2]
cagacuaauucu = QTNS 12nts before PRRA insertion
[hits DLG4, BACE1, HLA-A3, MAPK8, ADAM8, FOS JUN,…HLA-DRB3]
QTNS compliment = gucugauuaaga = VstopLR
so, LRPRRA [much stronger NTSR1/2, Furin, PCSK6, CFB, TMPRSS6]
LRGAAP [very strong NTSR1,2, Furin, CFB]
cguaguguagcu = RSVA 12nts after PRRA insertion
[WDR5,PCSK6, F2RL1, CFB]
RSVA compliment = gcaucacaucga = ASHR
[hits CFB, GRK2, C3AR1, WDR5, HLA-DRB3, AGTR2, HLA-A3]
so, GAAPASHR [hits C3AR1, CFB, WDR5, AGTR2, HLA-A3,
HLA-DRB3, SIRT1/2, AGTR1]
cagacuaauucuccucggcgggcacguaguguagcu (12+insertion+12)
QTNSPRRARSVA (12+insertion+12) [bad stuff w/HLA-A3]
NSPRRARSVA compliment LRGAAPASHR [strong CFB w/
AGTR1/2, GRK2, WDR5, C3AR1, SIRT1/2, HLA-DRB3, HLA-A3]
---
### Author:  [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)
#### Post date: [May 18, 2020, 12:08pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/80 "2020-05-18T12:08:00Z")
Great news from Moderna this morning:
_After two doses all participants evaluated to date across the 25 μg and 100 μg dose cohorts seroconverted with binding antibody levels at or above levels seen in convalescent sera_
_mRNA-1273 elicited neutralizing antibody titer levels in all eight initial participants across the 25 μg and 100 μg dose cohorts, reaching or exceeding neutralizing antibody titers generally seen in convalescent sera_
_mRNA-1273 was generally safe and well tolerated_
_mRNA-1273 provided full protection against viral replication in the lungs in a mouse challenge model_
_Anticipated dose for Phase 3 study between 25 μg and 100 μg; expected to start in July_
[https://investors.modernatx.com/news-releases/news-release-details/moderna-announces-positive-interim-phase-1-data-its-mrna-vaccine](https://investors.modernatx.com/news-releases/news-release-details/moderna-announces-positive-interim-phase-1-data-its-mrna-vaccine "Link httpsinvestorsmodernatxcomnews-releasesnews-release-detailsmoderna-announces-positive-interim-phase-1-data-its-mrna-vaccine")
---
### Author:  [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)
#### Post date: [July 1, 2020, 2:34pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/81 "2020-07-01T14:34:05Z")
Encouraging results from the BioNTech mRNA vaccine. 24 of the 24 volunteers injected at the two lower doses showed antibodies after 28 days at 1.8 to 2.8 times the level seen in recovered patients. The highest dosage was discontinued due to injection pain.
[https://www.medrxiv.org/content/10.1101/2020.06.30.20142570v1.full.pdf](https://www.medrxiv.org/content/10.1101/2020.06.30.20142570v1.full.pdf)
---
### Author:  [@rhiju](https://forum.eternagame.org/u/rhiju)
#### Post date: [July 27, 2020, 7:33pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/82 "2020-07-27T19:33:12Z")
Despite optimism with current mRNA vaccines, there’s a potential failure point that you may be hearing about.
Almost all the RNA vaccines are encoding for the coronavirus Spike (S) protein or subdomains of S.
There are now hints that antibodies against Spike protein vaccines may not last more than 3-6 months – the vaccines may not provide long-term protection. One paper:
[https://www.nejm.org/doi/full/10.1056/NEJMc2025179](https://www.nejm.org/doi/full/10.1056/NEJMc2025179)
We shouldn’t put all our eggs in the spike vaccine basket.
The other kind of vaccine displays peptide ‘epitopes’ that help boost not just antibodies but also cellular response. These are totally understudied at the moment, but may become increasingly important.
We have a multi-epitope vaccine candidate in our OpenVaccine challenges but should probably have more.
So I’d like to ask community to help scour the literature for potential additional epitopes and to _prioritize_ them for Eterna’s OpenVaccine designs. Eternacac and others got the ball rolling earlier in 2020. Its time to revisit! Let’s put findings and ideas here.
@DigitalEmbrace if you or others have a sec, maybe setting up a Google sheet compiling our candidates so far and notes would be very useful!
---
### Author:  [@DigitalEmbrace](https://forum.eternagame.org/u/DigitalEmbrace)
#### Post date: [July 27, 2020, 9:38pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/83 "2020-07-27T21:38:34Z")
Google sheet for compiling epitopes: [Epitope Candidates](https://docs.google.com/spreadsheets/d/1mHij80MWRM3tWso5f3S9wviqFaP-Bo52Ce5lOOc-sG0/edit?usp=sharing)
Fill in your top epitope ideas and I’ll work on compiling ideas from the forum as well.
---
### Author:  [@rhiju](https://forum.eternagame.org/u/rhiju)
#### Post date: [July 27, 2020, 10:02pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/84 "2020-07-27T22:02:46Z")
Another article explaining why we should look at epitope vaccines:
[https://www.sciencemag.org/news/2020/05/t-cells-found-covid-19-patients-bode-well-long-term-immunity](https://www.sciencemag.org/news/2020/05/t-cells-found-covid-19-patients-bode-well-long-term-immunity)
---
### Author:  [@rhiju](https://forum.eternagame.org/u/rhiju)
#### Post date: [July 27, 2020, 10:03pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/85 "2020-07-27T22:03:32Z")
Paper that checks every SARS-CoV-2 peptide as a potential antigenic epitope:
[https://www.nature.com/articles/s41392-020-00228-1](https://www.nature.com/articles/s41392-020-00228-1)
Which ones can we prioritize?
---
### Author:  [@whbob](https://forum.eternagame.org/u/whbob)
#### Post date: [July 27, 2020, 11:41pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/86 "2020-07-27T23:41:15Z")
I found this link to an article on epitopes for CoVid-19. It mentions OC43,HKU1, 229E,
NL63. There is a table of 9 aa epitopes but the data is a bit over my head.
From the end of the Results paragraph: It is of note that the S protein, which is the prime candidate for inducing neutralizing antibodies ([Cohen, 2020](https://f1000research.com/articles/9-285#ref-9)), is poorly suitable for inducing an MHC-I-restricted immune memory across the investigated viral species as between S protein of SARS-CoV-2 and S proteins of the common human coronaviruses there are no 9 aa matches, and, among the virus isolates compared in this study, only a single 8 aa match (DRLITGRL with HCoV-NL63 and -229E) (not shown).
The link is [Expected immune recognition of COVID-19 virus by... | F1000Research](https://f1000research.com/articles/9-285) .
---
### Author:  [@whbob](https://forum.eternagame.org/u/whbob)
#### Post date: [July 31, 2020, 3:39pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/87 "2020-07-31T15:39:37Z")
In the spirit of Rhiju’s request for epitopes in addition to targeting the Spike Protein, here is a short list of epitopes taken from this link: [Redirecting](https://dx.doi.org/10.1016%2Fj.micpath.2020.104236).
HTL specific epitope in the Membrane glycoprotein “NRFLYIIKLIFLWLL”.
B-cell specific binding epitope in the Membrane glycoprotein “RSMWSFNPETNILLNV” OR “SFRLFARTRSMWSFNP”.
CTL specific epitope in the Membrane glycoprotein “LSYFIASFR”.
The study found that Spike and Membrane received received about equal responses from the CD8+ T cells.
It also found that the HTL, CTL and B-cells together received CD8+ T cell responses. I got the impression that the HTL, CTL, and B cell antibodies were not present in the worst cases where patients did not survive.
The article is very specific and details the amino acid links to connect the epitopes together.
Could these be incorporated into our lab puzzles?
---
### Author:  [@eternacac](https://forum.eternagame.org/u/eternacac)
#### Post date: [August 8, 2020, 7:39pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/88 "2020-08-08T19:39:00Z")
Design of a Multiepitope-Based Peptide Vaccine against the E-Protein of Human COVID-19: An Immunoinformatics Approach
> **[BMRI2020-2683286.pdf](https://pmc.ncbi.nlm.nih.gov/articles/PMC7212276/pdf/BMRI2020-2683286.pdf)**
>
> 1817 B
they find 10 useful epitopes in the E-protein all of which should be considered especially the cytoplasm expressing one.
# Designing of a next generation multiepitope based vaccine (MEV) against SARS-COV-2: Immunoinformatics and _in silico_ approaches
Table 4 all epitopes
> **[2020.02.28.970343v1.full.pdf](https://www.biorxiv.org/content/10.1101/2020.02.28.970343v1.full.pdf)**
>
> 2.05 MB
as the CD8+ expression of Covid-19 patients is especially diminished emphasis on such epitopes may be preferred:
Mapping the T cell Response to Covid-19
[https://www.nature.com/articles/s41392-020-00228-1.pdf](https://www.nature.com/articles/s41392-020-00228-1.pdf)
---
### Author:  [@eternacac](https://forum.eternagame.org/u/eternacac)
#### Post date: [August 8, 2020, 10:49pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/89 "2020-08-08T22:49:45Z")
I would also suggest the epitopes chosen pay attention to the known pathways illustrated in this paper:
Type I and Type III Interferons –Induction, Signaling, Evasion, and Applicationto Combat COVID-19
> **[main.pdf](https://pmc.ncbi.nlm.nih.gov/articles/PMC7255347/pdf/main.pdf)**
>
> 1381.35 KB
---
### Author:  [@eternacac](https://forum.eternagame.org/u/eternacac)
#### Post date: [August 13, 2020, 8:09pm UTC](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140/90 "2020-08-13T20:09:22Z")
Identification of vaccine targets & design of vaccine against SARS-CoV-2 coronavirus using computational and deep learning-based approaches.
Tables 1-4
[https://files.osf.io/v1/resources/f8zyw/providers/osfstorage/5e8d8c6f43016601aba05283?action=download&direct&version=3](https://files.osf.io/v1/resources/f8zyw/providers/osfstorage/5e8d8c6f43016601aba05283?action=download&direct&version=3)
[Previous page](https://forum.eternagame.org/t/what-is-the-best-coronavirus-vaccine-or-therapeutic-to-eternalize/3140.md?page=3)