Building puzzles
another way
at the moment I have to create something like
…((((((((…))))((((((((…))))((((…))))))))))))…
and then solve it, and then (and only then can I publish it)
you could remove one level of skill
if I input
AAAGUUUCCCGGUUAAGCGCUAAAA or any other random string of bases
then it folds to some natural shape
perhaps that shape is a line - but if it’s not a simple line then the shape must have a notation.
But I think I’d struggle to create that notation - so why not allow someone to ‘grab’ the shape notation from the natural shape that they think looks interesting.
then they can mess about with bonds until they get something that looks challenging, grab the shape notation, and you know there is already a solution (and you can grab the existing sequence) So then you can paste that all into a challenge and upload it - by just typing in random bases into a 80 character long sequence. If it doesn’t form 1 or more pairs ignore it and otherwise you could publish all combinations of 80 bases as all the possible lab puzzles.
ok 4^80 (+ 4^79 + 4^78 etc) is a lot but many of them will be lines (no bonds) and can be immediately discounted
and then only some of them will have distinct shape notations - so any duplicate shape notations can be discarded
that then produces ‘every’ possible puzzle that can be completed as a lab candidate.
Edward 