If I start with a sequence GGGGGGUUUUUUUUUCCCCCC - I have no problem seeing that forms a nice simple hairpin.
But what happens if I were to take two such sequences and put them next to each other in the ‘ensemble’ (with room to move), would they a) end as two hairpins
or b) ‘top and tail’ with each other making something like this?
GGGGGGUUUUUUUUUCCCCCC
CCCCCC___________GGGGGG
________UUUUUUUUU
(please excuse the simple ‘graphics’, the underscores should be ignored)
And if the original target shape is more complex do you get little bits of the second strand connected to wrong bits or not?
So how to test it (perhaps there is nothing to test and I’m just adding complexity that doesn’t need to be considered?)
Well I imagine coding a whole new ‘second unconnected’ string is going to be difficult ?? If not, then that’s the suggestion and you can ignore pretty much everything from here down.
If it is difficult to code (as I suspect) I had an idea which might work (that starts here)
create a 5th dummy base (I’m presuming this is “just” an extra row in an sql table?)
I want that dummy base to act as ‘blank space’ - I’m going to call it X
That blank space (the base X) would need to be able to “pair with anything except itself” (so you could have things line up strangely) but also have zero ‘attraction’ (or almost zero) and it could (if you wanted it to look like it didn’t exist) have no graphic associated with it.
then you could take a chain
GGGGGGUUUUUUUUUCCCCCCxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGGGGUUUUUUUUUCCCCCC
and see how that folds (this example I think gives the two head to tail - rather than as hairpins) which might be interesting for complex sequences?
and then to check ‘right and left handedness’ you would also need to run
GGGGGGUUUUUUUUUCCCCCCxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCCCUUUUUUUUUGGGGG
(Which I think looks like two hairpins)
Ideally you as a player would only want to change the one sequence to stay in your target molecule - but you (the elite coder) might be able to add a button to the Labs which let a player ‘test with right handed copies’ (and another button to test with left handed copies)
Not sure if the way RNA folds means you can ignore one of the two options or not - possibly I’ve over complicated things.
I think (off the top of my head) the number of X bases would need to equal the total length of the chain plus 5 (minimum hairpin) to give the two chains maximum flexibilty to line up with any amount of overlap - I might be wrong about that.
Anyway that’s the end of this rough thought.
Hope it might actually prove useful
Edward ![]()