copies of the same chain - how do they interact

General Science Discussion
1

If I start with a sequence GGGGGGUUUUUUUUUCCCCCC - I have no problem seeing that forms a nice simple hairpin.

But what happens if I were to take two such sequences and put them next to each other in the ‘ensemble’ (with room to move), would they a) end as two hairpins
or b) ‘top and tail’ with each other making something like this?

GGGGGGUUUUUUUUUCCCCCC
CCCCCC___________GGGGGG
________UUUUUUUUU

(please excuse the simple ‘graphics’, the underscores should be ignored)

And if the original target shape is more complex do you get little bits of the second strand connected to wrong bits or not?

So how to test it (perhaps there is nothing to test and I’m just adding complexity that doesn’t need to be considered?)

Well I imagine coding a whole new ‘second unconnected’ string is going to be difficult ?? If not, then that’s the suggestion and you can ignore pretty much everything from here down.

If it is difficult to code (as I suspect) I had an idea which might work (that starts here)

create a 5th dummy base (I’m presuming this is “just” an extra row in an sql table?)

I want that dummy base to act as ‘blank space’ - I’m going to call it X
That blank space (the base X) would need to be able to “pair with anything except itself” (so you could have things line up strangely) but also have zero ‘attraction’ (or almost zero) and it could (if you wanted it to look like it didn’t exist) have no graphic associated with it.

then you could take a chain
GGGGGGUUUUUUUUUCCCCCCxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGGGGUUUUUUUUUCCCCCC

and see how that folds (this example I think gives the two head to tail - rather than as hairpins) which might be interesting for complex sequences?

and then to check ‘right and left handedness’ you would also need to run
GGGGGGUUUUUUUUUCCCCCCxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCCCUUUUUUUUUGGGGG
(Which I think looks like two hairpins)

Ideally you as a player would only want to change the one sequence to stay in your target molecule - but you (the elite coder) might be able to add a button to the Labs which let a player ‘test with right handed copies’ (and another button to test with left handed copies)

Not sure if the way RNA folds means you can ignore one of the two options or not - possibly I’ve over complicated things.
I think (off the top of my head) the number of X bases would need to equal the total length of the chain plus 5 (minimum hairpin) to give the two chains maximum flexibilty to line up with any amount of overlap - I might be wrong about that.

Anyway that’s the end of this rough thought.
Hope it might actually prove useful
Edward :slight_smile:

2

Hi Edward – this is a super-nice idea – an actually there is a method (called ‘co-fold’) to carry this out in the folding engine that we use. In fact, we are planning to put in ‘switch puzzles’ (where you design something that changes structure when it sees another message in the cell) in the near future.

Rrgarding your puzzle about GGGGGGUUUUUUUUUCCCCCC – in reality whether it forms a hairpin or duplex will depend on its concentration in solution – the duplex will win at high concentration. Its interesting, I just assigned a similar problem in my graduate class here – you’re quite ahead of the curve! In fact many RNA and DNA experimentalists were confused in the mid 1980s onwards when they tried to characterize natural hairpins (e.g. from viruses) by techniques like NMR or crystallography and instead started getting high-quality data on duplexes.

3

I’m just a game designer (with an A lvl biology 20 yrs ago) - so it’s nice to hear that I’m asking graduate level questions at least :slight_smile:

Interesting that the concentration of the solution favours the duplex - is there a theory that ‘explains’ why that is the case?

I did consider asking the more complex question about the interaction of ‘other series of bases’ but I thought I’d see how this thread panned out before I went too far down into the possible complexity, really great to hear that it’s in the pipeline.

I’m quite intrigued by the possibilities that brings.

Edward :slight_smile:

4

I do now wonder if the GGGGGGUUUUUUUUUCCCCCC chain would be scored as a successfully folded hairpin if it was synthesised in the Lab - or whether that would get a low rating (if most of the chains ended up as the duplex version due to concentration)

Do you count the duplex as 2 copies of the hairpin for the scoring results ?

Can you get triplex or even quadriplex that could be formed in a similar manner to the duplex? so something like this ? I’m guessing the free energy stops them forming ?

rough graphic attempt at quadriplex of that string

_________________G=C
_________________G=C
_________________G=C
_________________G=C
_________________G=C
_________________G=C
CCCCCCUUUUUUUUU__UUUUUUUUUGGGGGG
| | | | | |______________________ | | | | | |
GGGGGGUUUUUUUUU_UUUUUUUUUCCCCCC
_________________C=G
_________________C=G
_________________C=G
_________________C=G
_________________C=G
_________________C=G

These seem a bit like ‘harmonic frequency shadows’ of the same molecule

5

Interesting point! – the different shapes may in fact score equally well since our chemical mapping method only really reads out ‘paired’ vs. ‘unpaired’.

I don’t think we’ll have too many ‘degenerate’ sequences in future rounds, but we happen to have such challenges, we would probably have to repeat measurements at multiple RNA concentrations to help rule out any possibilities of shifting stoichiometry (single strand hairpin to duplex to 4-mer, etc.).

We are actually working on a protocol where we create all the EteRNA designs at once in one pool – this raises the possibiity of inter-molecular pairings – we are doing experiments to help test for the possibility of such pairings. The final protocol is still probably a few months away… stay tuned!

6

To answer the question about why the amount of dimer is dependent on RNA concentration, you can think of the ‘equilibrium’ as:

hairpin + hairpin duplex

Following Le Chatelier’s principle, the higher the RNA concentration, the more it favors the associated form. There’s actually a precise mathematical relationship, and we can/will try to include it in the game – the basic idea is the same as yours – the spacer of XXXXXXXX’s. Higher RNA concentration is a lot like having a shorter spacer – a higher ‘effective concentration’.