Error on mutation in pseudoknot puzzle

Feedback Bug Reports
1

Hi. I cannot start a new topic, so I’ll leave this here.
I get an error message just by switching a pair. Any suggestions?

Capture
Capture1420×898 51.3 KB

Error: Pair length doesn’t match sequence length
at i.set (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:963493)
at y.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:1560431)
at y.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:1536073)
at y.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:1537496)
at t._listener (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:1510732)
at a.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:3619)
at a.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:6796)
at a.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:31448)
at s.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:143544)
at s.value (https://eternagame.org/eternajs/dist/prod/main.ed66d33f89c9c20bbff2.js:2:430907)

2

Hi Creativa,

Typically I’ve seen that error occur when the folding engine (NUPACK specifically) fails, often due to running out of memory. This is a smaller puzzle, so I’d actually be quite surprised for it to be a memory issue. Do you have limited memory on your device or are running a (large) number of applications/browser tabs? Did you make a large number of mutations, potentially with a booster?

I’m assuming this is the recent lab. If you reload the page and get back to the same sequence, does it work again? If not, it could be helpful to know the sequence if there’s some specific issue with it.

3

Also as an aside, I’ve split this into a separate topic. When making a new topic in the feedback category, make sure to specifically put it in either bug reports or feature suggestions, you can’t put topics in the feedback category itself

4

Let’s say my computer is too old :´(
Thanks for your feedback!

5

I’d honestly hope that isn’t an issue - we want Eterna to be able to run on lower-end devices like Chromebooks, mobile devices, etc. So if that is the problem, there’s likely something we need to improve, or otherwise there may be something else going on!

6

Wanted to provide a quick update that there have been other players who have reported seeing this, and it appears that there is a bug in our implementation of NUPACK that causes it to crash on specific sequences with pseudoknots enabled. I can’t say when we’ll be able to look into this, but we are aware of the issue.

7

Found the error also so here is some ammo (evidence) to duplicate issue :
Seq:AGCACGUUUCGAAAAAAUCGAUUGCACCCAGAACACGCAAAAUCUGAAAAAAAAAGCGAAACAAAAAUCGAGGUGC
Bracket:.((({{…((((…)))).))).((((((…{{{…))))…}}}…}}.))…

HHH
HHH1153×765 228 KB

play with NT62 and watch icon in top LHC - goes purple and flip from target to natural to get error message.

Also in puzzle maker nat/tgt ratio blows sky high - which usually means a GU at the intersection of a open loop.