I am having a lot of trouble with the scroll bars (both horizontal and vertical). Specifically, I click with the intent of scrolling to a different place and nothing happens.
One issue is the scroll bars themselves. They have no outline to make the border evident, and in places the background blue is indistinguishable from the scroll bar blue.
The other, I realized, is that the hot spot for the error cursor is not where it seems to be. For an arrow cursor, one expects the hot spot to be the tip of the arrow. Because of the dark blue background coloring, the cursor shape is visually defined by the white outline, not the dark area that visually demarcates it on a light background. As a result, I am actually clicking about two pixels lower than where I think I am. (This is probably why I earlier claimed that the hot spot didnāt align with the visible icon, and you couldnāt reproduce that.)
I discovered a problem with the highlighting of designs (using ctrl-click) in the design browse list ā the marked items can spontaneously change, for no apparent reason. There is some loose correlation with pressing or lifting the control key, but it can happen with no more activity than moving the mouse. Hereās an example.
First a screenshot after marking 4 designs
I was intending to continue this pattern of marking every two, but without any clicking or pressing of keys, the screen changed to this:
About the cursor, the bad news is that I donāt even know where to start looking for a possible fix. Most of the time, this is hardware-accelerated, and I canāt imagine that the Flash applet actually toys with these thingsā¦ Iāll dig in the docs, but Iām not optimisticā¦
As for the scrollbars, these were the design decisions made by āprosā, the NOVA Lab team. Not being a trained UI designer myself, Iām reticent about questioning these things without the opinion of a specialist. Fortunately, we do have someone in the current team who should be able to tell me whatās the right thing to do. Iāll ask him at the next meeting.
This issue is not related to the NOVA port, itās quite an old one, and until now, I thought I was the only one who actually noticed it. So I had stacked it at the absolute bottom of my todo-list.
Since someone else is inconvenienced by it, Iāll raise this issueās priority a bit, but unfortunately, it is quite likely that it will take some longer time (easily weeks) before I can actually look into it.
I was solving some non-spacebar puzzles for a change today, found a minor complaint with the restraint boxes in the upper left, and was wondering if it tricked anyone else.
GU and AU pairs say āx or more,ā whereas GC pairs say āless than x,ā so having x GU or AU pairs is okay, whereas having x GC pairs is not okay.
So, in the above example, at first glance I would assume that 8 GC pairs is okay, and be disappointed to find out I have to remove yet another GC.
I would prefer for the GC pairs to say āx or fewerā if we continue with this format.
While messing around with this puzzle in PiP mode, attempting to activate the shape constraint highlighter in the 3rd state causes the applet to crash until itās deactivated.
CUGCCGAAACGGUGGAGUGCGCAAAGCGUGCACUGAUCAAAGAUUGGAGUGGCCAAAGGCUGCAGUGAGGAAACCUUGC with this sequence, the puzzle animations in the applet freezes in the second and third state (the background bubbles are still moving, so I donāt believe flash has crashed. This being on a different computer, OS, and browser from the original incident.
Well, this is clearly no crash, otherwise the applet would become totally unresponsive. And I would be unsurprised to find out that this is another bug in the highlighting code, which predates both the Nova port and my accessing the Flash code. I corrected an obvious one already, but it looks like thereās moreā¦ Iāll investigate.
and bingo, thatās a very old bug, one of those I like to categorize as ābutchered copy/pasteā, and amusingly, it would only sneakily trigger if your instability map has a lonely first base marked as unstableā¦
The fix will come in the next update. It is unclear when exactly this will happen thoughā¦
If you press the screenshot button twice, in quick succession, after the first op-up dialogue box is dismissed, the second proceeds to darken the screen but the dialogue options are not available to dismiss it, making the puzzle inaccessible.
Weird bug. Clicked on a link in chat, which caused all the subsequent and previous text in chat to be underlined. Unable to reproduce, so no clue what happened there
Nando, this is a long-standing bug. But given that youāve gotten familiar with the Flash code, I took some time to better characterize it, in the hope that it might make it fairly easy to track down and fix.
When moving the mouse over the expanded dot plot, there is a tooltip-type window that gives the coordinates. of the point under the cursor. But although the coordinates start out correct, they āquicklyā become incorrect. Iāve now identified completely reproducible scenarios, both for making them become incorrect and getting them reset to correctness.
To make them incorrect, simply move the mouse pointer outside of the dot plot. Bring the pointer back to the dot plot and they are wrong.
To get them back in synch, click on the zoom ā-ā area and move the pointer directly back to the dot plot.
Getting base pair coordinates is actually something I use quite a bit. Now that I know how to work around it, short of closing and re-opening the dot plot, itās a little less important to me that it be fixed. Still, it would be awfully nice if it could just work right.
Another probably related symptom is that sometimes, it just doesnāt work at all, with coordinates āfrozenā at (0,0) no matter where you move the cursorā¦
Sighā¦ noted. As you can imagine, this is low priority, so it may take some time before I can actually tackle that one.
