Map update failure?

Feedback Bug Reports
1

I was playing around with a Lab design a bit, and found a problem.

The sequence I was using was:
GGUUAUCUCAAGCGGGAUCAGUGAUAUAAUCAACAUCAGCACCAGGAUGGAGUUAGGCUAACGGCCAGGCCGAGAGAGAAAGAAACAACAACAACAAC

This sequence was stable.

Whenever I changed it to something unstable (in this case 23/31), it wouldn’t update the ‘map’, it would just give me the red error outline.

Not too big of a deal, but strange.

2

Dear Flashback

This problem has been filed in our task list with case #562. We’ll update this post with more details later.

Thanks for reporting!