Molecule not visible in single-shape PIP mode in switch puzzle but shows fine in multi-state PIP

Test Case
on this switch puzzle:


with this sequence in it
UCGGAUGAGGUAUCCUUGAUAUGAAACCAUCCAC

First, look at puzzle in multi-state PIP mode with both shapes visible at once
the molecule shows on shape 2
note the energy reading
now, change the PIP mode to single shape at a time
and look at just shape 2
the energy is the same (implying the molecule has been included)
but the molecule is not (on my screen) visible in the loop

Confirmed by LROPPY on Firefox and Chrome on Windows 10
Also confirmed by jnicol

Confirmed by ch1ck3n