Since the current lab puzzles have returned to using a bound MS2 protein as the puzzle output, I want to bring attention to a capability of the MS2 stamper that is not new, but seems to be largely unknown.
In 2014, the Greenleaf lab at Stanford published an extremely comprehensive study of MS2 hairpin affinity using the same type of array-based experiment Johan (who is a postdoc in the Greenleaf lab) is doing for Eterna. They measured more than 10 million mutations of the MS2 hairpin loop, and found many that had essentially the same affinity as the standard sequence. Nando took 24 of the best of these, and added them to the MS2 stamper.
Here is the list of variant sequences that are programmed into the stamper:
I have colored then with R/Y colors, and grouped them according to their R/Y patterns. The fact that there are so many variations means that there are many more opportunities for selecting kernel attraction sequences that are not present in the standard sequence.
To get the in-game stamper to generate one of these sequences, you use it in the normal way, but click on the same starting base multiple times. Each time you click on the starting base, you will get the next alternative sequence. Or, if you know which sequence you want to use, you can use the new stamper booster to place the sequence wherever you wish.
There is one gotcha associated with using an alternative sequence – the constraint boxes that show whether or not the hairpin forms (or doesn’t) for each state doesn’t recognize the alternative sequences. So you have to verify for yourself that you have a intended sequence when it comes time to submit, and accept the warning that your design doesn’t meet the constraints. I’m sure @nando could modify the constraint to accept any of the variations the stamper generates, but I don’t know the level of effort that would take.
If you want to see the sequences listed in the order the stamper cycles through, that list is at http://www.eternagame.org/web/script/5851203/ . And you might want to look at the paper itself, because there are a lot of other sequences that are almost as good as the standard one. Here’s a neat graph that indicates the binding energy for all possible single and double mutation variations.
You can find the full paper by going to http://greenleaf.stanford.edu/portfolio_details_buenrostro_2014_nature_biotechnology.html and clicking on the magnifying glass in the lower right corner.
I have one minor thing to add. I found myself wanting to use one of the alternative MS2’s but hit the lab limit with max 3 C’s in line. One of the alternative MS2’s have 4 C’s.
I wanted to use this sequence for the Same State - Tryptophan B lab:
GUAGCUAUCGCGGCCGCCACUAAACCGGAAACGGAACAGGAGGAUCACCCCUGUGGCGAAAGCCAUAGGACCGGGCGAUAGCUAC
So one of the alternative MS2’s are out of the equation. It is in the MS2 stamper too.
I solved the problem by changing one of the C’s to something else so I could submit the puzzle with my own alternative MS2.
I had made a small list for myself at one point, so I am VERY GLAD you posted this.
I have used some alt_Ms2 designs and wondered if the game recognized them yet—it should. Coding should only involve building a list a checking it, but then I’m not a true coder…
But in evaluating these alt_Ms2 designs my green-box system can only give an automatic score of 9 since the game doesn’t recognize state1 or state2. I have to do that by observation of secondary shapes displayed onscreen.
I have sorted some of the above alt_Ms2 forms by stem strength base pairs as follows:
Atl_Ms2 forms available in Eterna
Sorted by stem strength base pairs
I also note that in some designs some of these alt-Ms2 forms may be directly substituted no other alterations needed and pass muster with Vienna, Vienna2, and Nupack looking nearly identical in the games ‘green box’ presentations and secondary shapes/ dotplots.
