Player/dev collaboration needed to create an effective, rapid, in-round Select-Test-Publish-Analyze cycle

[Eli_Fisker]

The seed of the spiral orientation

There seems to be a pattern for the orientation of the spiral in relation to how the puzzle looks. The way the design bends around the turned off aptamer, hints of the orientation of the spiral. 

• If the design bends clockwise, the spiral bends clockwise
• If the design bends counterclockwise, the spiral bends counterclockwise

Exclusion Example

https://eternagame.org/game/browse/8791823/?filter1=Id&filter1_arg2=9006204&filter1_arg1=9006204

https://eternagame.org/game/browse/8791823/?filter1=Id&filter1_arg2=9006118&filter1_arg1=9006118

Same State Example

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002640&filter1_arg1=9002640

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002443&filter1_arg1=9002443

In the Tryptophan designs it seems to be the tryptophan aptamer that is strongest and decides the orientation of the spiral. Same for designs with theophylline (at least those labs I have managed to make spirals in so far). Where as for the differently typed Exclusion FMN designs, it appears to be FMN that controls the spiral action.

Challenge

Now this spiral pattern being closely connected with the design bend seems a emerging trend. 

What I will be very interested in, can you guys make exceptions?

Can you make: 

• designs that bends clockwise, but have the spiral bend counterclockwise?
• designs that bends counterclockwise but have the spiral bend clockwise?

[Poll_na_gColm]

Does this one count?

[Poll_na_gColm]

This is a more scrunched up progression of the previous

Or is using an FMN exclusion lab cheating a bit?

[Eli_Fisker]

Poll na gColm, thx for testing this out. 

This makes me realize that I should have added some more advice. So hereby my apology. 

The switching area in the design needs to have switching stem moving after each other in a line. Small stems in the switching area seems to break the spirally area.  

Keep up the testing.  

[Eli_Fisker]

Also it is okay to use the FMN exclusion too. That is no cheating. For now it seems it behave in a similar way bespite being an OFF switch and the others are ON switches. 

And I do give you points for solving the task as I stated it. I didn’t specify well enough. 

[Eli_Fisker]

Poll na gColm’s entangled aptamers causing spirals

You found a different way of making spirals. High five!

The spirals are made by entangling the aptamers. It actually stands out in the image highlight that I shared before. 

I dug up the puzzles behind the mirrored spiral arc plots above for the FMN Exclusion A (MGA). 

Clockwise - Big MGA aptamer side closest to FMN2 (Last FMN sequence)

https://eternagame.org/game/browse/8791824/?filter1=Id&filter1_arg2=9004919&filter1_arg1=9004919

Counterclockwise - Big MGA aptamer side closest to FMN1 (First FMN sequence)

https://eternagame.org/game/browse/8791824/?filter1=Id&filter1_arg2=9005167&filter1_arg1=9005167

[Poll_na_gColm]

This is as close as I’ve managed so far for Tryptophan B Same State MGA

[Eli_Fisker]

Static stem deletion mystery solved

A while back I was wondering if the static stem that tended to turn up at specific spots in the switching area in lab designs were having a function. (Background forum post - See the section No static stem) Beyond the more obvious benefit of hiding away excess bases.

I got a chance to test this in round 101 where we got 8 sublabs with the FMN/MS2 riboswitches labs that had the aptamer placed such a way that there were no longer space for a static stem in the switching area, as the other labs allowed for.

I submitted sequences from earlier winners that did have a static stem, but just with with the sequence from the static stem part excluded. I expected the miniaturized designs to take a score hit. They all did, but one. So generally the static stem did seem to have a function. But that one exception have had me mystified since. I wrote about this design.

I can now explain why this particular design managed to escape the score hit dealt by the missing static stem. 

The static stem deletion caused a style change in the resulting design. Its arc plot is of the spiral kind. I think the spiral designs have a potential for reaching a far higher fold change than the circularized design style. 

Spiral Arc Plot Needle in a circle Arc Plot Haystack

I was watching past lab winners in jandersonlee’s arc plot tool when I stumbled over this arc plot. It was a spiral. I looked up the design and realized that this was the design that had me baffeled from my #StaticStemDeletion experiment. It is from the one design from my static stem deletion experiments that had a better fold change than the original winning design that had the static stem.

I toggled the design from state to state and indeed this design a microspiral - a miniaturized spiral design. A shorter train of stems sliding. Watch how it slides. Just like the many recent spiral designs in the open lab.

https://eternagame.org/game/browse/6369346/?filter1=Id&filter1_arg2=6453151&filter1_arg1=6453151

Spiral designs with special switch graph signature

In addition to the spiral arc plot, the design had a curious switch graph.

https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6453151.png

I am wondering if the two curves not meeting at the right end of the graph image, means that the design has not gone through its full switch potential within the time limit.

I have found other designs with spiral arc plots that have the same switch graph signature that shares traits with my #StaticStemDeletion - JL SNG1 3.00 18 - variant 3 design.

Just to mention Zama’s Tryp B SS (MGA) ZZ-1-18 and Jieux’s Comedy 1 #all3 #staticstem from the lightning round 1 were also spirals, show the same switch graph behaviour.

Image borrowed from the newspost News on the Fast Track Experiments

It’s the same case for the switch graph of ViennaUTC’s big spiral that gets the best fold change of all the small loops labs from Round 101.

https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6438980.png

https://eternagame.org/game/browse/6369383/?filter1=Id&filter1_arg2=6438980&filter1_arg1=6438980

It is possible to find spirals that don’t show this exact switch graph pattern. Like this switch graph for the spiral design by ViennaUTC from the partner lab. It doesn’t have this switch graph curves as the other spirals. Best fold change of all the 8 Small Loop labs. Eg this one:

https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6433626.png

https://eternagame.org/game/browse/6369377/?filter1=Id&filter1_arg2=6433626&filter1_arg1=6433626

But I find it fascinating that the designs with spiral arc plots also seems so show early tendencies of trending toward getting distinct switch graph curves. The designs with spiral arc plot are different to the designs with circularized arc plots. 

[Eli_Fisker]

The round 4 batch from the lightning round had a bunch of working spirals along, in particular in the Tryptophan B Same State (Spinach) lab. 

Many of the spiral designs (green boxes) had switch graphs where the blue and red line were apart and don’t meet at the end (to the right). Just as the switch graphs I pointed out for earlier spiral lab designs. 

I have added arc plot type to each design. Plus the #SB and #BS reveals the orientation of the spinach aptamer. B stands for big (longest side of the aptamer) and S stands for small (shortest side of the aptamer). That way I can use the same abbreviation for different aptamers. I use these hashtags on my lab designs, as for being able to group the designs after types. 

So far there have been mainly counterclockwise spirals for the lightning round. 

The patterns that seems to be there so far is that the Tryptophan B Same State (Spinach) with the best fold change and wide switch graph have in common, are that they are spiral designs + they use a selfturnoff binding for the tryptophan aptamer. Plus the two designs with the best fold change (27.7 and 19.5) + wide switch graph have in common, compared to the other designs, are that they have static stems at one end of both aptamers.

Arguably some of the Tryptophan A Same State (Spinach) designs employed the same strategies, but with less luck. The one with the best fold change (but also the lowest response) did both spiral and use tryptophan aptamer selfturnoff. (Jieux’s Tidy Monster design)

Advice for round 5

If you are into spirals as am I, make sure you try out both clockwise and counterclockwise spirals. Plus try these out in combination with different aptamer orientation. That way we make better sure that we hit on what works best. 

[Zama]

You said above: Many of the spiral designs (green boxes) had switch graphs where the blue and red line were apart and don’t meet at the end (to the right). Just as the switch graphs I pointed out for earlier spiral lab designs.  My question is- would the goal be for them to meet on the right?

[Eli_Fisker]

From what I understand, if the designs are tested at a longer time they may. I think Omei and others can explain the details better. From what I see the designs aren’t finished switching. They are slow starters and slow finishers. Compared to the more typical winners in RNA origami solve style designs with more circularized arc plots. 

Zama also sent me a question in relation to my image in the above post: 

Hi Eli, I’m not seeing the clockwise in this design???

Ok, I think I know what happened. I saw two spirals and since I have a habit of taking one road if I can, I just continued outward counterclockwise after I reached the middle. Normally I go from outside and in when I count what orientation it is.

Zama is correct. Both these spirals are clockwise going outside in. 

Another thing, is that what spiral is in native and in states are not always the same way. Normally I count spiral orientation from states. Now I can’t remember any design in particular, but I know I have seen designs where the spiral went one orientation in states and the opposite in natural.

Can you guys find examples?

[DigitalEmbrace]

For me, a document that briefly outlines the current best practices (or results analysis) for designing in a lab would be helpful. I also think a glossary would be helpful for quick reference.

For instance, a few days ago mgotrik popped onto chat to make sure players knew to avoid entangled aptamers in the lightning rounds. 1) That info could be added to a best practice doc. 2) “Entangled aptamer” is one of the terms not clearly defined for me. I spent an hour reading through forums and am still not completely sure. (Is an entangled aptamer the same as sell-turnoff aptamers? Or does it imply bends in the aptamers also?)

Another example, I’m not sure all players are aware that Vienna2 is delivering the most accurate model in the lighting rounds. (Or is this not true?)

I guess the best way to implement either of these suggestions would be a google doc linked in the main lab page or in one of the News posts. The google docs could be constantly updated by advanced players as we discover better practices and invent new terms. I’d be happy to help edit any docs for clarity and brevity.

[DigitalEmbrace]

I use the mutation booster regularly to look for new designs. After pruning, I click through designs to find desired fold shapes. I don’t submit all mutations, only the ones I like. And Jeff’s new arcplot tool, holy cow, blowing my mind. I use it not only to identify good designs, but also to find and fix weak pairings.

[Gerry_Smith]

Given the visual analytics eterna thrives on, is it much of a leap for the visual gaming programmers who are making such inroads at developing programs to beat computer games to come up with script-like visual tools that players could use to test strategies and find designs with the parameters they set? How to expand eterna into this community?

[jandersonlee]

Vienna2 is not necessarily the best model, it’s just the one for which we have the more detailed tools (arcplot). In theory we could add NuPACK to arcplot if someone had the time to do a little coding for me.

[Eli_Fisker]

Hi DigitalEmbrace!

An entangled aptamer is two different aptamers that are entangled in such a way that for the one to form, the other have to be literally broken. So the aptamers are taking turns excluding each other. It’s a trick that Jieux started in the FMN exclusion lab. It can only be used for exclusion designs. 

Here is a tutorial puzzle introducing the concept. 

https://eternagame.org/web/puzzle/8827766/

An aptamer selfturnoff is different to entangled aptamers. 

AN aptamer selfturnoff is the sequence of one aptamer, that when the aptamer is to be turned of, is turned off within itself. 

Here is a scripted tutorial demonstrating this in practice. 

https://eternagame.org/web/puzzle/8957760/

[Eli_Fisker]

Lightning round voting strategy proposal

I have a proposal for voting strategy for Puzzles for lightning round 6, for those of you who are into spirals like me. 

There are main 4 types of spirals:

1. Clockwise spiral (#CW) and big MGA aptamer sequence before the short MGA aptamer sequence (#BS)
2. Clockwise spiral (#CW) and short MGA aptamer sequence before the big MGA aptamer sequence (#SB)
3. Counterclockwise spiral (#CCW) and big MGA aptamer sequence before the short MGA aptamer sequence (#BS)
4. Counterclockwise spiral (#CCW) and short MGA aptamer sequence before the big MGA aptamer sequence (#SB)

While I try make a bunch of spirals in each of these 4 categories, I am not asking you to vote for my spirals. Pick  whatever spirals you like best. What I’m asking is when you cast your vote for spiral designs, that you try pick one spiral in each of these 4 categories. 

The reason I ask is that I hope is that we get a complete or near complete set of all 4 spiral types through the voting process. This may help start get an idea what orientation for spirals and MGA aptamers that may be best in these two labs. Which again may help us on what future lab rounds want. 

[Eli_Fisker]

Zama brought up something today that I think will be a helpful perspective on spirals. Hereby I bring part of our discussion. 

zama: Many of our spirals resemble Fermat’s Spirals. I’m curious if there is a way to gauge how close we can get to them?

eli: I think it has to with how you fill the loops out inbetween the sliding stems that are creating the spiral.

If you make an even number of loop bases on both sides, you will get a straight stem. I have a puzzle demonstrating.

Or rather I have 3 puzzles, that may get you a sense of it. https://eternagame.org/web/puzzle/9023368/

https://eternagame.org/web/puzzle/9024748/

https://eternagame.org/web/puzzle/9007424/

zama: @Thanks- and here I’ve been trying to avoid doing player puzzles lately- lol!

eli: In fibonacci spirals the spiral is growing, it isn’t equally close all the way. To create a growing spiral you will need to add more single bases in loops on both sides in a growing pattern.

Hehe

you can usually count on mine having something to do with lab.

Unless cynwulf has got me curious on something.

zama: The Fermat Spiral doesn’t grow like the Fibonacci- why I thought ours looked more like a Fermat

eli: Ah, yes, I see I misunderstood

https://i.pinimg.com/236x/fe/90/ce/fe90cea2119fc32c69aeb6fcfece298e–alchemy-spirals.jpg

Ok, then you should be perfectly fine with even side loops on both sides of the sliding stems

as this puzzle

https://eternagame.org/web/puzzle/9023368/

Actually the sides in the above image seems to get smaller (edited)

zama: Do you think the Fermat could be duplicated in design?

eli: I think it already has

That Pi design, as I recall it has the fermat patterns as what you showed

zama: 

I wondering if the closer a design is to matching the Fermat equation the better the score??

eli: GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC

That is a fine hypothesis

Now the spiral doesn’t go the whole way through both of them. But there is a black strong line suggesting a bond will form and connect the two spirals. (with light green highlight)

Perhaps easier to see now:

Link to Pi’s design: https://eternagame.org/game/browse/7559902/?filter1_arg1=7612876&filter1=Id&filter1_arg2=761…

zama: The design of yours that I posted above looks closer to me.

eli: Can you give me a link to it?

zama: It’s from the google doc your working on. https://eternagame.org/game/browse/8787266/?filter1=Id&filter1_arg2=9037947&filter1_arg1=903…

eli: Mine only gets one full spiral through

Try play with the chain marker in the arc plot tool. First unmark, then choose chain. You can shift color by holding down shift

What I mean your fermat spiral image has two intertwined spirals both originating from the center of the sequence.

That is almost what Pi’s design does

zama: Ok, it looks more like the Fermat image you posted.

eli: Yup. single fermat

I like this fermat illustration as the color contrast hightlights the inverted mirroring.

found it here: https://codea.io/talk/discussion/1770/fermats-spiral-another-experiment-with-large-images-meshes-and…

I see that the spiral arc plot you posted next to your fermat image is single spiral. But your fermat image is double spiral, just as my fermat image is single spiral. Both kind of arc plots are there. My arc plot represents the single fermat image and Pi’s arc plot represent the two nested fermat spirals. (edited)

So really when we vote for spirals we should vote for 8 different types of designs.

4 single fermat spiral types + 4 double fermat spiral types

Recipe for double spirals

Ok, I’m not sure the double spirals are possible in same state labs. Pi’s design is an exclusion lab. And there the aptamers have to counter each other. One be on in one state and another be on in another state. 

Actually there are. They just look a bit different to Pi’s exclusion double spiral. They instead get a characteristic snail shape. 

Here is a good example from a previous post. 

It is from Dl2007’s design with fold ratio 1.13 (from Lightning round 4 results).

Watching Dl2007’s design, I think the road to making double spirals is to focus on one of the aptamers. Then to pick two spots in this aptamer that can both pair with themselves in one state (1) and then have these two spots bind two places else in state 2, and have those two new partner spots in state 2 perhaps bind somewhere in state 1. 

Kind of like this: 

While we haven’t seen high scores for double spiral designs yet, I would like to see them getting made and also voted for just as the same 4 types that I wish to see single spirals for. 

[Eli_Fisker]

Another wish if you use hashtags to signal spirals. I would like to have the spiral orientation first (#CCW or #CW) and then the MGA aptamer orientation (#SB or #BS) after. Then they can be searched out at the same time and isolated together. So eg. #CCW #SB not #SB #CCW.

If you manage to make a double spiral as described in the next post below, I would be happy if you stick a #double after the other two hashtags. Like #CCW #SB #double

Or if it is a single spiral #CCW #SB #single

Again. Don’t go back and change your previous designs. Just know that adding these hashtags in a fairly similar way will make it easier for us to analyse the data afterwards and drag useful trends faster. 

[Zama]

Reminder: Eli is reading spiral direction (counterclockwise vs. clockwise) from the outside of the circle inward. I was reading it from the inside out, which would make it just the opposite.