I don’t think spirals will switch very well, way to crunchy.
How can a spiral be crunchy. First we have to take a look at the arc plot. The top is a nt to nt map of state 1 and the bottom is a nt to nt map of state 2 connected with lines that creates an arc The olgios are marked on the rna string in red and blue. The spaces between the arcs look void but are really nt’s that can’t find a match. Too many voids in the spiral and no switch, the rna string looks jagged with kinks in the string, hence crunchy, difficult to match with 1 state much less switch. It’s like finding your date in a really dark room and everyone is standing in a line. You have to convince your next door neighbors to head in the direction you want to go. The magenta arcs are the beginning and ending of the olgios and the stats below are for those pairings. The X factors at the end are a shot at the probability strength of that pair closing.
I would think a flowing spiral or wavy arc plot may give better results, where the switch happens by stack movements and not by small groups of nts movements.
2 Likes
On the other hand, If you structure it right a spiral structure can enable a gradual transition that doesn’t require a complete undo/redo of the RNA shape to switch.
Suppose that site B2 binds with B1 or B3 and B3 binds with B2 or B4 and B4 bonds with B3 or B5. You can get B1=B2+B3=B4+B5 or B1+B2=B3+B4=B5. to switch between the two you must unpair two sites and pair up two sites.
However because of the sliding/spiral structure it can happen one site at a time: B1=B2+B3=B4+B5 to B1=B2+B3+B4+B5 to B1=B2+B3+B4=B5 to B1+B2+B3+B4=B5 to B1+B2=B3+B4=B5.
In contrast, a looping either/or case where B1 bonds to B2 or B4 and B3 bonds to B2 or B4, you must break both sites to switch: B1=B2+B3=B4 to B1+B2+B3=B4 to B1+B2+B3+B4 to B1+B2=B3+B4 to B1=B4+B2=B3, Yes, the order switched, but think .(((…)))…(((…))). to …(((…))). to … to …(((…)))… to .(((…(((…)))…))).
1 Like
Excellent points, JR
“Too many voids in the spiral and no switch, the rna string looks jagged with kinks in the string, hence crunchy, difficult to match with 1 state much less switch. It’s like finding your date in a really dark room and everyone is standing in a line. You have to convince your next door neighbors to head in the direction you want to go.”
The more usual winning design type that is circularized in the arc plot is a slam dunk.
“Too many voids in the spiral and no switch”
For a same state spiral design:
The spiral pattern is to have several strands that are in line in switching stems in the first state, swap their partner in the second state, for one further down the line than they were supposed to go - but in a fixed interval. Them all moving at once in a coreagraphed dance move, is what it may take to your next door neighbours to head in the direction you want to go.
The spiral winners have so far been very rare. I agree that they are much harder to make work. But when they do work, I think they will be well worth the wait.
Eli, I have been reviewing a number of designs which satisfy Lab criteria in one or more engines and have found that some of these designs presented a challenge to categorization (possibly not a good sign for those designs). Here is one such example, my “Design 001” from the Tryptophan A Same State (MGA) Lab:
ACUGCACUGGCGGUAACGAAUGUUCGAUACCGAGGACCGGUACGGCCGCCACUCGUUCUAUCUUGAGCCGACGCCUGUGCUGAAA
I’m curious how you would categorize the Arc Plot for this design.
Cynwulf, this is a good question. I agree with you that this is a most mysterious arc-plot. It looks most like a static RNA design.
In States
In Natural:
I found your design in the lab: https://eternagame.org/game/browse/8787266/?filter1=Id&filter1_arg2=8885846&filter1_arg1=888…
One thing that may help explain the arc-plot is that the design is not stable in vienna2, while it is in Vienna and Nupack.
The tool can be used with Nupack and Vienna too, but it may explain part of the weirdness in the above design that it is not stable in Vienna2. To be honest I don’t know. Jandersonlee is best in this department.
There is a section on energy models in the Arc-Plot Tool Intro.
There are other strange arc-plots. Mixtures. Show us your weirdest. 
The arcplot tool may eventually be able to use other energy models once it is a Booster. In the meantime, designs that only work in other than Vienna2 may look weird, at least in Natural mode.
1 Like
Lab design challenge - can you invert the arc plot spirals?
I challenge you.
Can you make counterclockwise spirals for the tryptophan labs?
Can you make clockwise spirals for the theophylline labs?
If you manage, please post your images here.
Outline from discussion between Omei and I
Eli: So there is even orientation to spirals.
Well it is merely impossible making the opposite spiral to the one orientation the aptamer seems to like the best.
I’m still going to try
Omei: I can certainly see why there is a preference that depends on which half-aptamer has the strongest turnoff candidate. But I would be surprised if it is generally impossible to use (a perhaps less favorable) one from the other half to make the spiral go the other way.
eli: Yes, it should be possible somehow, but I suspect less preferably with some aptamers.
Probably a bit of hyperbole caused by my frustration by the attempt.
omei: Do you think there is something other than which half-aptamer has the strongest turnoff sequence that comes into play?
eli: Yes, what partner aptamer/reporter there is in use.
I have also had trouble with one specific orientation of the spinach aptamer
MS2 is stronger than FMN. I also think tryptophan is stronger than MGA
at least when it somes to sequence and binding habits
My biggest trouble with the spinach ones are that there is so little left over bases to get the job done with. Longer sequence and no problems.
omei: Yes, the reporter is really just a second aptamer when it comes to folding. It’s only the way the experiment is done that distinguishes input from output.
eli: So I think the strongest aptamer will determine the orientation of the spiral
omei: Good point.
I was running through the arcplots of a mutation series yesterday and noticed several designs had a clean arcplot and good numbers (percentages/ratios/kcal) while several other designs had a noisier arcplot but very high numbers (99% 300x). It seems the current thinking is that a clean arcplot with a racetrack is a better indicator of successful switching than high numbers?
1 Like
We don’t yet know what is best, so I’m trying to submit an across the board variety so that we can see what works. That said, my sense is you don’t want the dotplot/arcplot “too clean” or it may indicate a reluctance to switch (a few highly stable states) nor too dirty (largely unstable). For this round at least I’m throwing in designs from 5x to 5000x, but mostly 20x to 500x as long as the ON percentage is over 50%. Also there are several dependency chain patterns (loop, spiral, double spiral, mixed) so I’m also going for a variety of those.
@DigitalEmbrace The motivation for liking a “clean” arcplot is that the folding engine predicts that there won’t be a lot of chance for the design to fold into ways that are neither of the desired ON and OFF foldings. My own observations of past data lead me to say that it is a good criterion for avoiding many “mushy” designs, but by itself is certainly not a definitive indication of what the measured fold change will be. If anybody had already figured out a good way to predict the fold change, there would be no need for us to be doing these experiments.
It’s for the FMN Exclusion A lab, but I got the spirals to pretty much go in reverse
3 Likes
Very cool Pol! How did you get it to do that?
I can’t help but wonder if aptamer selfturnoffs and spirally arc plots really are two sides of the same coin. Because they seem to come in combination.
The new aptamers that contrary to FMN have a prebuilt in option for aptamer selfturnoff seem to spark spirally arc plots to a far greater degree than the earlier FMN/MS2 riboswitches.
(While FMN aptamers can get a selfturnoff, if a sequence that is complementary to the aptamer loop gets placed in the aptamer gate.) These FMN aptamer gate selfturnoff designs work by a similar mechanism. They typically have a bunch of pyrimidines (C&U’s) in the aptamer gate that fits both in the aptamer gate, when the FMN is formed, but also is complementary to the side of the FMN loop that is furthest away in the sequence.
1 Like
Is orientation of arc plot spirals depending on the aptamer?
Zama spilled that she had a collection of Tryptophan A Same State Spinach spirals. She asked if anyone was interested in seeing. I was.
I decided to take a stab at guessing the spiral orientation before viewing the collection.
My bet was on that most of the spirals for that lab would be clockwise in orientation
When following the arc from outside and towards the design.
I based this on my own designs and the behaviour I seen of aptamer selfturnoffs.
I even see this preference for a specific direction in spirals for designs that do not use aptamer selfturnoffs but have a nearby sequence in the aptamer gate shut off the aptamer. I think it is the aptamer that is causing this directionality for the spirals.
Different aptamer may mean different orientated spirals.
But each aptamer may have its specific preference.
Zama’s collection and all clockwise spirals
And I got my wishes. Both getting Zama’s collection and the clockwise spirals. Zama’s collection confirmed.
She has uploaded the collection on google docs. Here is the link.
Thoughts on aptamers and their effect on arc plot spirals
If I’m correct and the aptamerselfturnoff, or turnoff sequences are involved in sparking the spiralling arc plots, then I will expect the spirals to take a specific preference in what way they are spinning. Clockwise or counterclockwise.
Theophylline seems to spark counterclockwise spirals. But otherwise most of the spirals I have seen so far are going clockwise. (If following the arc from outside and in).
Here is an example
Preliminary prediction
- Tryptophan will spark more clockwise spirals
I base this on that all my design in the Tryptophan lab A lab, are clockwise in spiral + in Zama’s design collection.
- Theophylline will spark more counterclockwise spirals
I base the latter on Pi’s double spiral design.
https://eternagame.org/game/browse/7559902/?filter1_arg1=7612876&filter1=Id&filter1_arg2=7612876
Plus the two spiral designs I have made myself in Theophylline B Same State (MGA)
https://eternagame.org/game/browse/8787272/?filter1=Id&filter1_arg2=8994994&filter1_arg1=8994994
https://eternagame.org/game/browse/8787272/?filter1=Id&filter1_arg2=8994975&filter1_arg1=8994975
Local aptamer turnoff sequence and spirals
Now aptamerselfturnoffs isn’t solely involved in sparking spirals. In labs where the aptamer is split in two it also happens by a nearby aptamer turnoff sequence placed in the aptamer gate. (The switching stem closing the moving end of the aptamer)
For the tryptophan and theophylline aptamer which both are asymmetric aptamers, the local aptamerturnoff sequence has a habit of preferring to kick in one specific direction - all based on how the aptamer prefers to move when it gets turned off.
Here is tryptophan kicking opposite direction between the states.
Which of the aptamer sequences are the strongest?
So maybe it is more by the movement of the aptamer itself turning off and there typically being one side of the two aptamer sequences that is stronger than the other. The strongest side will be more likely to be involved in sparking the spiral.
Theo B labs - Theo 2 is stronger - counterclockwise spiral
Tryp B labs - Tryp 1 is stronger - clockwise spiral
For FMN B labs - FMN 2 is stronger - counterclockwise spiral?
Special thx to Zama for having shared her collection. It helped clear up my wondering way faster than I could otherwise have done.
Zama’s Secret Sauce to spirals
As Zama said: I made that recipe looking only at the spinach- never liked spinach
Here is a lab discussion between Zama, I and later Omei too from a few days back.
Zama: @channel, here is the list for Trypto A SS Spinach. I didn’t take the time to add links but the names are included and each is followed by a screenshot of the arcplot. I made a note if there were other similar mods. *The Secret Sauce*" for spotting a spiral (at least in this lab) is- *No multiloops in State 1, although a small hairpin near the static neck might be tolerated.* (edited)
Trypto A- SS- Spinach Spirals Google Doc - aka Zama’s book of spirals
Eli: Beautiful collection - big thx!
Zama: I’d love to hear everyone’s opinion on which are best?
Eli: So far I like Dl2007’s the best as they are fairly clean and very green.
There is one of Mee’s looking real good too.
I’m basing this solely on color visuals.
The one of Mee’s is the one with 0301 in the title
Zama: What about the last one- Astromon’s?
Eli: It has some darker lines in the background on the top half of the arc plot
that may want to fold differently
But not bad.
One thing I notice is that many of these spirals have a little bit of circularized nature in them.
Zama: Can you define or give an example of what you mean?
Eli: Here is a more pure spiral by tone
https://eternagame.org/game/browse/8789142/?filter1=Id&filter1_arg2=8950120&filter1_arg1=8950120
I can’t say for sure that the more pure version will do better than the slightly less spirally. Because the best FMN/MS2 aptamer with the best fold change so far for riboswitches, had an almost pure spirally pattern, but with a slight turn in the middle.
Zama: Can you give an example of what you call circular?
Eli: The ones that are like yin and yang shapes
if you draw a line through them, they are ring like as they can often be connected
while they are not round circles
more like salvador dali circles
or watches
Zama:
Like this- with it setting on top of a spiral?
Eli: Example of circularized arc plot
https://eternagame.org/game/browse/6369186/?filter1=Id&filter1_arg2=6423405&filter1_arg1=6423405
And the design you show above is a spiral
let me see if I can find one of the mixtures
Zama: I saw tons of those- they are the ones with the multiloops. Were you saying you were seeing a lot of circulars in my collection?
Eli: No, Zama.
Just that a few of them have a slight hint of the circularized arc plot
Lots of designs in the labs aren’t pure forms, but mixtures
Zama: Ah, that’s where I got confused- and yes, some are on the border.
Eli: Well observed
And sometimes it also happens in the middle
Ok, here is one - actually one of those I like for their clean look.
I cheated a little and drew just the border
It has that yin and yang border feature
despite also being a spiral
Zama: Yes, those differ considerably to the kind of spiral we got in round 1- like Jieux’s.
Eli: Yes
Notice that stem highlighted in state 1. This is the one giving the change.
Normally both moving part in both states of a pure spiral design will look very much the same.
They will be two or three switching stems in line. And all that happens is that they swap their partners for different ones between states.
Zama: Yea, that’s one of those little hairpins in the static neck loop that seem to be tolerated.
The ones I were referring to- nice to know what they do
Eli: Yes
Example of the stems lining up in spiral designs:
Zama: Yep, no multiloops
Eli: Well put
I marked all the switching bases that pairs. Most of them become paired in both states
On the no multiloop observation, the spiral designs behave quite opposite to the circularized designs. The latter seems to make a virtue out of getting multiloops in.
Omei: I think the difference between a “pure spiral” and the “almost pure spiral” of the best FMN/MS2 designs is a very significant difference.
A pure spiral implies the absence of a multi-loop, and hence only a single hairpin loop. As I recall, one of the first things we measured in the earliest array labs were the number of hairpins in each state, and those with only one hairpin in each state, on the whole, were the worst group.
I think it is quite possible that pure spirals will turn out to have good fold changes, perhaps the best, but only if the experiments are done differently, i.e. allow more time to pass between changing conditions, to give the slower full spiral switches time to come to equilibrium.
This time factor (which the lab coats refer to as kinetics, as opposed to thermodynamics, is something that Eterna has tended to ignore, largely because the science of RNA kinetics really lags behind that of RNA thermodynamics.
Eli: Double aptamer design with best fold change 157
At first when I drew it up on paper, I thought it to be a true spiral, but it has a little detour from the spiral pattern in the middle.
I have been wondering if we can make a true spiral work in such a lab or if it would need a little longer sequence.
Omei: That would probably make it switch even more slowly, making it appear to be worse in the current experiments.
Eli: Yes, so a defect added somewhere strategic, while spoiling the pattern a little, may work the best.
Omei: I argued for Eterna to explicitly address kinetics questions. Rhiju was interested in talking about it, and came up with medical scenario where it would be important.
But there’s too many other things going on right now, I think, to introduce that as new types of puzzles.
What I do think is possible is to start getting players talking about the significance of switching speed, so we can ask the experimenters to routinely publish the timing of the various steps for each round. If nothing else, that will give us a baseline for comparing results with future experiments that do explicitly treat time as an experimental variable.
1 Like
I was playing around to see how many pairs I could make static and fortunately they formed a nice neat fold. So then I just moved one half of the MGA to the other side and built the exact same pattern in reverse
1 Like
Poll seemed to change the direction of the spiral by orientating the Aptamer in the opposite placement of it. https://getsatisfaction.com/eternagame/topics/player-dev-collaboration-needed-to-create-an-effective…
1 Like
Well noticed, Astromon!
Here are two inverted spirals from the Tryptophan B Same State (Spinach) lab
Counterclockwise spiral and clockwise spiral
Clockwise spiral (left spiral arc-plot)
https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002640&filter1_arg1=9002640
Counterclockwise spiral (right spiral arc-plot)
https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002443&filter1_arg1=9002443
This one is a near pure spiral, but has a tiny stem forming (aptamer selfturnoff).
1 Like