Oops, you’re right Astromon- it was the Trypto B-SS ZZ-1-18 that was rapid tested, not the FMN A- Exc. ZZ-1-18. I guess I need to find a better numbering system. I totally missed that- good catch!
1 Like
Sigh! Astromon and Zama, you are both right. I went for the wrong FMN lab.
When I now look at the correct design switching design by Zama, it is of the type that has aptamer selfturnoff instead. Which is a nice result also.
Hi Poll na gColm!
This can happen sometimes. I am not sure why. However I found a sequence of yours that is closely related to the one you show above.
I can reproduce your output with it.
Link to the design:
https://eternagame.org/game/browse/8791823/?filter1_arg1=8986067&filter1=Id&filter1_arg2=898…
Sequence:
AAUAAUGUUGGAGGAUAUGUGCGGUAACGAAUGCCUUAAUUCUGGUAACGAAUGGCGAAACGCCCGACAGAAGGCCGACGCACAA
P.S. Try swap to the States mode, it will give you a slightly less pretty but more interesting view of your design.
I noticed that the aptamer in the arc plot didn’t turn up the same place in your design. Your design is a double aptamer design. The tool goes for the strongest of the aptamer and draws its blue lines to highlight that one.
I have highlighted the two aptamers in your puzzle.
See the section in the Arc-Plot Tool Intro called Marking and Automarking.
The Arc Plot is a nice tool. Might create a one line output of stats on bottom so we can cut/paste into comments in the lab that is easily readable… Thanks for your efforts.
What information would you like in a one-line summary? I’ve been grabbing all four lines myself at least for descriptions. You could add each line as a separate comment.
Is the Arc Plot tool using Vienna2. I have Nupack designs that “work” where Vienna2 says not working. The Arc Plot data seems to support Vienna2 version of the designs. Is this correct?
Ah, yes. It is a Double Reporter (MGA) case. The tool is supposed to detect multiple potential reporter sites and pick the one with the better energy, but in this case it seems to be fooled. I guess multiple aptamer/reporter sites needs more work. Any two bases can be marked as a pair. If the PAIRING% is too low, it treats is as zero and omits the details.
might just html it so it copies into 4 lines. My copy now displays one single line which makes it less readable. Yes, I know, I am pretty lazy, I could do that myself.
ARC-PLOT PATTERN IN WINNING DESIGNS
What do these winners have in common?
Here are 4 winning designs all from different labs, but with the best fold change of their lab. (I have ignored any design that has a fold change error above 1.25)
- Anything stands out to you?
-
Just focus on the green lines. Ignore all the black and grey.
-
Now the big outer circle is the neck (static stem). Smaller green circles are static stems in the design. Also ignore these.
Zama asked: “Are you referring to the S wave?”
You are getting there.
-
What can be done with the S wave? Could you highlight it in an image?
-
Just pick one of the arc plots above and draw the S wave
-
What would it look like if you follow the line of the green shape?
-
Now do anything stand out?
-
What do these designs have in common?
-
You can draw a line through the green arc plot part of the switching bases.
The shape of the arc plots can take many forms, also for winning designs. Even designs with messier arc-plot shapes can be winners. The above ones are from different labs. 3 Same State and 1 Exclusion design.
Thx to Zama for being my guinea pig for how I could share this story.
Link to the designs
https://eternagame.org/game/browse/6369184/?filter1_arg1=6456004&filter1=Id&filter1_arg2=6456004
https://eternagame.org/game/browse/7568412/?filter1_arg1=7650114&filter1=Id&filter1_arg2=7650114
https://eternagame.org/game/browse/7559901/?filter1_arg1=7721394&filter1=Id&filter1_arg2=7721394
https://eternagame.org/game/browse/6369186/?filter1=Id&filter1_arg2=6423405&filter1_arg1=6423405
Arc plot of a low scoring design
Notice that many of the green tracks can’t be connected between the top half of the arc-plot (state 1) and the bottom half of the arc-plot (state 2)
Score 32%
https://eternagame.org/game/browse/6369196/?filter1=Id&filter1_arg2=6487563&filter1_arg1=6487563
THE MAZE OF THE ARC-PLOT
I have been drawing on Omei’s EternaCon presentation slide. Notice that the bot designs takes much longer roads.
Observations so far
Jeff has made an awesome new RNA visualization tool. The Arc Plot Tool. I have focused this new lab microscope at the usual suspects - past lab winners. Here are some tendencies.
-
One can draw one road through the arcs in the arc plots of a good design.
-
The shorter the road, the better the switch
-
The road the arc-plot take in human designs is typically shorter than the bots. (Rhiju calls the robot arc plots swirly)
-
The road through the arc plot takes different types of routes.
-
There is a high fraction of the bases that are directly involved in switching, that switches in both states (bound in both states, but somewhere different)
-
Magnet segments runs through the arc plot roads
One road track
The winning designs I have checked so far - even if structurally very different - seems to have something particular in common.
One can draw one road through the arcs in the arc plot. With the focus only on the part of the sequence that do base pairing and who’s base pairing in state 1, also becomes base pairing in state 2. Then follow the route where base pairing connect between state 1 and 2. So where arcs are touching between state 1 and 2.
What this means in short is that bases that are bound in state 1 also a high likelihood of being bound in state 2 (but somewhere different).
Example design with the best fold change for Exclusion NG 2, Round 101. Score 96%, fold change 37.35. This is a blueprint style design with a circularized arc plot
https://eternagame.org/game/browse/6369184/?filter1_arg1=6456004&filter1=Id&filter1_arg2=6456004
I marked the bound and unbound bases in the design above. What the arc road means in practice is that bases that are bound in state 1 also a high likelihood of being bound in state 2 (but somewhere different). Which is particular handsome to know when one is to design from scratch.
Predictive power and a strong tool for designing
If one know the position of the reporter and the aptamer, one can predict very likely rutes a design will need to take - to make it get a race track arc plot.
Take PWKR’s FMN/MS2 double aptamer design. (Winning mod of it) One can literally draw up the known part - the position at where the MS2 and double FMN is placed in state state 2 when they are to bind their molecules. Then knowing the race track benefit, one can draw up the missing part. There will be only few options left.
Then one could draw the road through, like this:
I actually did the above drawing first, based on the winning double aptamer design. After which I realized that I could have guessed the road, had I not known how to solve the double aptamer in the first place.
Omei’s different race tracks
Another thing I’m also interested in is that this one way road through the arc plot takes different roads depending on the design solve style. Omei calls the roads for race tracks. He began wondering how many unique racetrack patterns there could be with six crossing points. He drew up classes of them.
Omei’s Unique racetracks with six crossing points
I for the fun of it came up with some names based on the shapes.
Class 1: E type
Class 2: Snake type
Class 3: Spiral type (Fibonacci)
Magnet segments
I have been talking a lot about magnet segments earlier. I have also drawn how they interconnected between states.
However it shows up much clearer in arc plots. Here it can be followed how the GG and CC cross between the states being connected for the whole or part of the way. They turn up like this in a lot of the other winners too. There typically are one such double GG and CC around. Here they are in the center of the switching strand of bases.
Racetrack width
The road isn’t always straight when it crosses over from state 1 to state 2 or in reverse.
It is sometimes skewed. I think the skewing can be beneficial too, I think the skewing can go to help the bindings unstick easier.
There is a specific spot where the race track meet between state 1 and 2, that is more skewed apart from each other than other places. One place it often happens is at the neck spot in a design.
https://eternagame.org/game/browse/6369184/?filter1_arg1=6456004&filter1=Id&filter1_arg2=6456004
I have noticed this in some of the riboswitch designs like the above one earlier. There are overhangs between the regions that pairs. I tried eliminate those for a period because I found a clean switch between state 1 and state two switching strands would be pretty. Like all switching bases in 1 state become switching bases in state 2 also and no extras. Plus opposite.
1 Like
Keep experimenting…
Zama commented on my post and mentioned something important that I wish to highlight.
“Just read it- very nice but you put great emphasis on the curve and don’t give an example of what a spiral ( I see a tornado) might look like in the plot. I fear players will immediately dismiss any design they don’t immediately see a curve in.”
I think she has an excellent point. She also proposed a solution. Namely to use the two designs that we got positive results back on via the fast track lab. As she argued, the designs will be closer to what we are are reviewing now. Also the Light-Up labs with aptamer against aptamer is a new lab type. So here comes the example designs and their arc plots.
Tryp B SS (MGA) ZZ-1-18, fold change 6.2
https://eternagame.org/game/browse/8787268/?filter1=Id&filter1_arg2=8813946&filter1_arg1=8813946
Very spirally arc-plot
Comedy 1 FMN B EXC, fold change 34.1
https://eternagame.org/game/browse/8791823/?filter1=Id&filter1_arg2=8825121&filter1_arg1=8825121
Spirally arc-plot
Spirally arc-plots tends to happen when the switch does a slide or glide. Try open the above designs and make sure to have single window view. Then flip between the states to see.
1 Like
Looking at Round 3 votes now (3:46 pm EDT) … there are none. Voting must have ended early?
Are the round 1,2 & 3 fold change graphs going to be available is a particular location? In the wiki perhaps?
There must be some confusion about which puzzles are being drawn from. They are FMN B Exclusion (MGA) and Tryptophan B Same State (MGA). These are the same two puzzles we drew from in Round 1. Make sure you sort the designs on Votes, in descending order, to bring them to the top.
As for the arc plots, which I presume is what you are asking about, the tool is now available to all players at http://35.185.225.39:8888/arcplot.html. See the recent news post for more details, including the arc plot tool guide. With that in place, I’m not intending to produce them manually for all the contenders any more. But if you or someone else want to do that for future rounds and share it with players, that would be great!
Yes, I must have back arrowed to the wrong list:(
I was actually thinking that the Fold Change graphs above (shown after the first rapid response feedback, bead-based experiments) would continue for rounds 2 and 3.
I’m trying to understand the arc plot now. Loops, shades and colors, oh my! Lots to take in and having fun doing it. Thanks.
Those “fold change” graphs, which are equivalent to what we have called switch graphs in the past, will continue to be the graphical form for reporting experimental results. The arc plots, on the other hand, are the in-silico energy model’s prediction of the collection (ensemble) of all the foldings. Our lab experiments can’t discern the individual foldings; they are changing too fast. The experiments essentially measure the weighted average of all the foldings in the ensemble.
HOW TO CREATE A DESIGN WITH A SPIRAL ARC-PLOT
This is a recipe for how to create a design with a spirally arc-plot from scratch. There are a few discussion areas along since jandersonlee helped me along the way. I left it as is. The letter/number notation is his addition. Plus the fine arc-plots off cause. Notice that we can now make an autochain marking, so clicking one basepairing will light up the whole chain of dependency.
1) What design type is it?
-
If it is a same state design - place the aptamer and the reporter at a distance
-
If it is an or an exclusion design, place the aptamer and the reporter fairly close. (Not necessarily right next to each other)
In this case it was a Same state design.
2) Make both switch elements stable by putting some stabilizing base pairs around them.
Lab: https://eternagame.org/game/browse/8787272/
3) Make a drawing of all the preplaced elements
Since it is a same state design, the aptamer and reporter both needs to be bound in state 2. This gives you their complete positions with closing stems which will give you the arcs for the bottom half of your arc-plot drawing. Plus you have the neck, that you can draw for both state 1 and 2.
To make the drawing, plot in all the stem area. So the Neck, the stem closing the bottom end of the Theophylline aptamer (aptamer gate) The stem that closes the opening end of the MGA aptamer and the Stem that closes the end of the MGA aptamer.
4) Connect the roads at the roads are missing ( ? )
The roads can only be connected in 2 possible ways, if the arc plot is to give a spiral. Here is one of them.
Actually you can make the spiral even shorter, if you keep the MGA closing hairpin stem static.
(Wouldn’t that tend to leave MGA on in state 1? Isn’t it by crossing G4 to G5 that MGA turns off, or can G4 just match enough of MGA1 to turn it off?) I can try make one later, to see if I can make it work. - I managed. See the last section in the doc. [Very nice. -j.]
[Can you label the gates/magnets/whatever - Gate1, Gate2, Gate3, … in a spiral such that:
Theo1+Gate1 bonds to Gate2+Theo2 in state 2 in the image above
Gate2+Theo2 bonds to Gate3+MGA1 in state 1 (or to Theo1+Gate1 in state 2)
Gate3+MGA1 bonds to MGA2+Gate4 in state 2 (or to Gate2+Theo1 in state 1)
MGA2+Gate4 bonds to Gate3+MGA1 in state 2 (or to MGA1+Gate5 in state 1)
MGA1+Gate5 bonds to Gate6+MGA2 in state 2 (or to MGA2+Gate4 in state 1)
I.e. Neck1 Theo1 G1 … G3 MGA1 G5 … G6 MGA2 G4 … G2 Theo2 Neck2
The alternative spiral would flip the states with the similar pairings.
…]There are a few changes in state 1. I have bolded them.
Alternative spiral
State 1 connections
-
Neck to neck (N1 to N2)
-
MGA1 aptamer gate (G3) to MGA hairpin stem (G6)
-
Theo1 aptamer gate (G1) to MGA2 aptamer gate (G4)
State 2 connections
-
Neck to neck (N1 to N2)
-
Theo1 aptamer gate (G1) to Theo2 gate (G2)
-
MGA1 aptamer gate (G3) to MGA2 aptamer gate (G4)
-
MGA1 hairpin stem end (G5) to MGA2 hairpin stem end (G6)
5) Connect the strands in the puzzle
State 2 connections
-
Neck to neck (N1 to N2)
-
Theo1 aptamer gate (G1) to Theo2 gate (G2)
-
MGA1 aptamer gate (G3) to MGA2 aptamer gate (G4)
-
MGA1 hairpin stem end (G5) to MGA2 hairpin stem end (G6)
State 1 connections
-
Neck to neck (N1 to N2)
-
MGA1 aptamer gate (G3) to Theo2 aptamer gate (G2)
-
MGA1 hairpin stem end (G5) to MGA2 aptamer gate (G4)
6) Pair up the above regions in the lab puzzle
First I marked the stem regions (the mmmmm) in the drawing above, in the puzzle itself. I highlighted them with ctrl+click. So Theo1 aptamer gate (G1), MGA1 aptamer gate (G3), MGA1 hairpin stem end (G5), MGA2 hairpin stem end (G6), MGA aptamer gate (G4) and Theo2 aptamer gate (G2). Then I focused only on the pairings that I needed to make for state 1.
G3 needs to match with G2 and G5 needs to match with G4. I froze the puzzle while I was working on it. Putting in the complementarities.
I made sure that Theo2 aptamer gate (G2) matched up with MGA1 aptamer gate (G3) by making them complementary. Then I filled in matching bases to them where they were placed in the puzzle to lock them in place. (Base 21-23)
I probably should have taken more of the stems themselves instead of biting in the loops. However I saw this as a chance for an easy solve.
Then I made sure MGA1 hairpin stem end (G5) matched to MGA2 aptamer gate. (G4)
Again I probably took a bit too much of the loop along. Anyway.
I judged that I had a close to solved design and all I did was turn the mutation booster on it and let it make a solve.
Sequence: GCACCAGGUACGGAUACCAGUAAUAUCCGGGUAACGAAUGCCAGUAGGCCGACUGGAUAUUACCCUUGGCAGCCGUACCUGGUGC
Lab: https://eternagame.org/game/browse/8787272/
Here are the results:
GCACCAGGUACGGAUACCAGUAAUUGCCGGGUAACGAAUGCCAGUAGGCCGACUGGCAAUUACCCUUGGCAGCCGUACCUGGUGC,UG@25+CA@57,true
GCACCAGGUACGGAUACCAGUAAUUGCCGGGUAACGAAUGCCAGUAGGCCGACUGGGAAUUACCCUUGGCAGCCGUACCUGGUGC,UG@25+GA@57,true
GCACCAGGUACGGAUACCAGUAAUUGCCGGGUAACGAAUGCCAGUAGGCCGACUGGUAAUUACCCUUGGCAGCCGUACCUGGUGC,UG@25+UA@57,true
What I ended with:
https://eternagame.org/game/browse/8787272/?filter1=Id&filter1_arg2=8994975&filter1_arg1=899…
Sequence: GCACCAGGUACGGAUACCAGUAACUGCCGGGUAACGAAUGCCAGUAGGCCGACUGGCGGUUACCCUUGGCAGCCGUACCUGGUGC
Miniaturizing spirals by making a switching stem static instead
I have created a microspiral by making the hairpin stem closing the MGA hairpin static. I strengthened the cross over in state 1 that I left untouched. Then I turned the mutation booster (base 24-25+ 58-59) on the puzzle again and got a bunch of solves.
Sequence:
GCACCAGGUACGGAUACCAGUAAGUCAAGGGUAACGAAUGCCGAAAGGCCGACCUUGUUUUACCCUUGGCAGCCGUACCUGGUGC
https://eternagame.org/game/browse/8787272/?filter1=Id&filter1_arg2=8994994&filter1_arg1=899…
Fantastic!!! I love those spirals!! THANK YOU!
Why don’t we have more working double aptamer designs?
I regularly get asked if double aptamer designs have shown to work. Lately I got asked if there were other examples of working double aptamer designs outside the FMN/MS2 labs.
I only have one near working example. Design with second highest score in the Kissing loops lab Same State - Tryptophan B.
Score 86%, fold change 9.33, extra tryptophan aptamer marked
https://eternagame.org/game/solution/7656242/7691440/copyandview/
So why haven’t we had many working double aptamers since the Same State NG 2. I think for two reasons.
- They mostly haven’t done the fold exactly like PWKR’s FMN/MS2 double aptamer design - having stem bases in state 1 pair up with stem bases in state 2, and pairing in the same spots.
PWKR mod, score 100%, fold change 157.06, the all time best fold change for our riboswitches
https://eternagame.org/game/browse/6369196/?filter1=Id&filter1_arg2=6415623&filter1_arg1=6415623
Notice that most of the switching bases that pairing in state 1 are also pairing in state 2. Just somewhere different. And vice versa.
- Too short sequence length (FMN is the smallest of the aptamers we work with, most of the other aptamers are much bigger.) Give us longer sequences and I expect that we shall spew more likely to work double aptamers.
Details on reason 1. There is a deep connection between state 1 and 2.
An arc-plot drawing based on PWKR’s design as it shows in the game.
So just because a double aptamer design looks like PWKR’s for state 2, where all the aptamers are bound, if it doesn’t look similar to the PWKR design for the state 1 or some other legal racetrack pattern, it may not work.
So I think many of our double aptamers have failed for just that reason. Because the switching bases in state 1 did not connect up in the same spots as they did in PWKR’s designs.
Now this design is very close to being a spiral design. I would love to see if a true spiral version is possible, when we get a lab that will allow us to test that.
Fibonacci spirals - how perfect is that! 
Now if anyone wonders why I’m so obsessed with spirals, here comes an explanation.
Thx to Zama for giving me the title. Also for making me look for fibonacci spirals in RNA in the first place. She asked if RNA could be fibonacci like.
The title is what she happily said to me, when she realized that RNA fibonacci spirals was exactly what she was going to get. She asked for it, I’m happy we can bring it to her thx to jandersonlee’s arc-plot tool.
The following group of designs I bring up have been outliers from what has been more normal and have caused me great wonder.
Most of this is excerpts from earlier conversations
There is one design I am particularly fascinated with. Even before the arc plots.
Exclusion - Theophylline B, fold change 29.26, score 100% and switching bases 50
https://eternagame.org/game/browse/7559902/?filter1_arg1=7612876&filter1=Id&filter1_arg2=7612876
It’s an unusual exclusion design, in that it doesn’t have its ms2 right next to the aptamer. It doesn’t have coaxial stacking either, no static stem either. It does not follow the path of the more typical riboswitch winner of the circularized type, with a circularized arc-plot. Also it uses more bases to switch than the more usual circularized solve style (blueprint type) designs. But it is the best scoring design in its lab.
But when I run it in the arc tool, it still get this one way road through. Although spirally.
Actually one can discuss if it is just one road or it is two separate spirals.
It kind of reminds me of a spiral galaxy (as per wiki: https://en.wikipedia.org/wiki/Spiral_galaxy)
Another way to say double spiral is double fibonacci. 
Ok, to sum up what I’m saying: If we look at just the blueprint style designs that are circularized in solve style and arc plot, then the Same State designs can be solved using fewer bases than Exclusion designs.
This solve style is a fast way of hitting winners and make then in a structurally similar way. However there is a way to achieve a higher fold change, but also involves involves using more switching bases.
And that solve style seems to involve more gliding or sliding switches and they tend to have a more spirally arc plot.
Which reminds me of the miniaturized lab from round 101. They were made to investigate if we could delete the bases of the static stem in our bigger MS2/FMN riboswitches, without it having an effect on the design score and fold change. In one case it didn’t have a negative effect on the designs, but in all the other cases it did. Some of the better designs of those small labs, showed the same stress effect, that I have seen in labs like Exclusion 1 and 3 (where the switch elements are not optimally placed in relation to each other. (FMN-FMN-MS2 or MS2-FMN-FMN instead of the better FMN-MS2-FMN)
The designs that did better in these labs that we had a hard time solving, tended to go more full moving switch - get most bases involved in switching. (Those with inverted aptamers) (edited)
jandersonlee: Eli. In arcplot you can select multiple pairs to highlight the arcs in cyan (blue-green):
GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC
https://eternagame.org/game/browse/7559902/?filter1_arg1=7612876&filter1=Id&filter1_arg2=7612876
Eli: Wow, this is beautiful. I like it!
You even made it go through the magnet segments
jandersonlee: I want to make it so that arcplot can pick out dependency chains and possibly mark/unmark them as a group.
Eli: I love that plan
Omei: It looks to me like there are two independent dependency chains going on in this design.
Eli:
I managed to draw in the additional spiral.
It even has its own set of magnet segments too
I find it interesting that this second set of magnet segment is a flavor of the first, but different in size.
Omei … which suggest multiple marking colors would be nice.
Jandersonlee: Well, what I call a dependency chain involves state1/state2 MFE pairs such as: C17=G69-C27+G56-C40 in the above
Eli: I also love that idea
jandersonlee: so yes, there can be multiple chains
Eli: The design of jandersonlee, the gliding switch that got the better fold change of the single aptamer designs in SS NG 2 also got a whiff of double spiral or 2 set of dependencies. (Jandersonlee’s gliding switch.)
Eli: I think this spiral concept is key to get to an even better fold change than what we can get with a single road dependency and circularized arc plots.
Another thing I find fascinating in the above arc plot is that the magnet segments for both chains gets smaller the more toward the middle of the plot they get.
One of the spirals are much longer than the other.
The smaller spiral origin alongside the bigger spiral
jandersonlee: You can find a single chain of 4-pairs for each
Eli: fascinating. It is much harder to see from the get go because not all of the 4 bases pairs up in all of the sections of the arc road.
jandersonlee: It may be enough to have one track that switches back and forth. The chain C17=G69-C27=G56-C40 has two pairs in state 1 (-) and two pairs in state 2 (=). To switch states you need to break two and make two. The inner pair must break first, so it could be C17.G69-C27.G56-C40 to C17.G69.C27.G56-C40 to C17=G69.C27.G56-C40 to C17=G69.C27.G56-C40 to C17=G69.C27.G56.C40 to C17=G69.C27=G56.C40. If you can ‘roll’ (or unzip/rezip) the base pair like this you don’t have to break all the bases to change states. If the aptamer bases can switch first, they can perhaps free whatever blockage is preventing the reporter site from forming.
In the GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC example, 4 pairs must break from state 1 before the first key state 2 aptamer pair can form:
Eli: “If you can ‘roll’ (or unzip/rezip) the base pair like this you don’t have to break all the bases to change states.”
jandersonlee
Eli: That’s what I think too is the potential strength of the spirally arc plot designs.
They do not fully overlap in the same manner as the more origami style designs
So one get a longer time for moving towards a switch
so also potentially greater fold change
So it gives a more gradual switch
omei: @eli how many examples of “spirally” designs can you identify?
Eli: I can mention the two late winners in the fast track lab too
Eli: Omei, I can not say for sure that spirals are going to be better than circularized designs. It is just the few outliers that have giving me a headache for long that starts show a pattern. I see the emerging of a new trend.
(Plus two from the miniature labs in round 101, those were the two designs with best fold change of all the 8 small loops labs.)
Fold change 33.28, score 100%, switching bases - most
https://eternagame.org/game/browse/6369383/?filter1=Id&filter1_arg2=6438980&filter1_arg1=6438980
Fold change 40.44, score 90%, switching bases - most
https://eternagame.org/game/browse/6369377/?filter1=Id&filter1_arg2=6433626&filter1_arg1=6433626
Both the labs, the design structure and the arc plots are like inversions of each other.
Both designs switch over the middle of the sequence
jandersonlee: I might actually consider this a double spiral and quasi-circular combination.
Eli: Yes there is more than just one spiral
Omei: Eli, do you know if Vinnie produced similar spirals in other puzzles, and they just didn’t compete well?
Eli: I don’t know, but I suspect it has
It tends to use all the space
Omei: It could be instructive to identify something about the puzzles that dictated a different “best” strategy.
Eli: The arcs still almost crossover in the above spirals, although they are more skewed in relation to each other than the other arc spirals so far.
Eli: Its funny. Vienna sometimes goes in between spiral and circularized. I have found a few spirally like designs. Which isn’t odd since it often do slides/glides.
Omei: If I understand correctly, it is not pattern-directed at all.
jandersonlee: I believe that it is not pattern directed.
That patterns seem to show up in winning designs is therefore all the more interesting.
Eli: It makes all kinds of arc plots
also pure circularized
So I take it too that it is random.
jandersonlee: Not circular, not spiral. partially double-spiral.
Eli: I agree with that, Jeff. It’s like the arc plot was cut up in the middle and then moved a bit.
Omei: I see a yin-yang pattern.
jandersonlee: So a third pattern of switch design?
Or just chaos?
Eli:
Quasi spiral
skewed
Doupler effect
redshift
Omei: Jeff, Why did you call yours a partial double spiral. Just because the length of the spiral segments were different?
… and what sequence was that?
Eli: Many of the arcs in this plot do not overlap between state 1 and 2, but are exactly pushed and beside each other. So that could be a fourth strategy. Intersecting
Omei: I’ve been wondering whether “ideal” matching is best, with “defects” forced by the length between the half-aptamers.
That’s one thing very nice about Jeff’s tool – you can change the spacing between aptamer halves, for both aptamers.
jandersonlee: I think it was https://eternagame.org/game/browse/6369377/?filter1_arg1=6433626&filter1=Id&filter1_arg2=643… “Rereedve” by ViennaUCT Score 90
Omei: Thanks. Looks good.
jandersonlee:
Pure spiral
Double Spiral: in and out
Eli: So the two vinnie designs I shared showed a spiral can be made if one make a puzzle fold over the half and make each half of those sequence also fit with each other when they are turned the other way.
jandersonlee: Failed loop - almost but not quite looping back on itself GUAGCUAUCGGAGGAUAUUCAUACCGGAAACGGACAUGAGGAUCACCCAUGUGGCGAAAGCCUUGGGAGAAGGCUGAUAGCUAC
Eli: The above type regularly misses just a base or two (typically at the aptamer spot) so it can’t fully circularize.
jandersonlee: I suspect a loop of more than 4 is resistant to switching as all bases must break to switch (edited)
Eli: Its kind of like the one of the aptamer sequences (typically also the strongest one) is split in two.
and each half of it is an overhang in one state or the other.
So it is kind of a break or weaker spot in the ring
Omei: That sounds right. Which would imply it would be a good switch for a “memory element”.
Eli: I tried make perfect matches between 4 strands. With no overhangs. And it didn’t work well
1 Like