Controls are essential for quality experimentation so I started there. I quickly obtained a sequence for CRISPR/Cas9-Control ON
[http://www.eternagame.org/game/puzzle/8047255/]: GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCUCUAUGAUAUUCGCGAAAGCGAAUAUAUACCACAUGAGGAUCACCCAUGUGGUAUAUACAAUGGAAACAUUGUAUCAUAGAGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
I pasted this same sequence into the CRISPR/Cas9-Control ON (freestyle) puzzle as well [http://www.eternagame.org/game/puzzle/8047523/].
I began the CRISPR/Cas9-Control OFF puzzles as well [http://www.eternagame.org/game/puzzle/8047448/ and http://www.eternagame.org/game/puzzle/8047524/] and noticed several things about these four puzzles:
1) The Oligo (Target DNA: CUGCGUAUUUCUACUCUGAG) is bound in every single state which confers -39.3 kcal of energy (through bonds), yet there appears to be a penalty of 28.22 kcal listed where the energy from the Oligo would normally appear.
2) Having pasted the exact same sequence into each of the four puzzles I looked at the Total Energy listed (sans the 28.22 kcal) and found that for the CRISPR/Cas9-Control OFF, OFF (freestyle), and ON (freestyle) the number provided (in white) was -114.2, while for the CRISPR/Cas9-Control ON the energy given was -113.8. The difference comes from a single bond (GU) which is formed ( ONLY in Control ON ) between bases 21 and 131. This bond adds -1.4 kcal of energy to the stack while causing the energy in the open “hook” to be -1.5 kcal. This bond does not form in the other three puzzles where the unpaired bases make the hook energy -5.4 kcal.
3) In the Control OFF puzzle one of the criteria is that the, “MS2 hairpin must not form in state 1” (despite the puzzle not actually being a switch with Control ON [is that the plan?]), yet the outlined structure that the RNA is required to fold into INCLUDES THE MS2 HAIRPIN! Thus, if the MS2 sequence (ACAUGAGGAUCACCCAUGU) is pasted in the same place as in Control ON puzzle, then this puzzle is unsolvable. Luckily the puzzle is possible if we stamp the MS2 hairpin elsewhere in the puzzle. The following sequence demonstrates how CRISPR/Cas9-Control OFF may be solved: GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUAAUAUGUGAUAUAUGAAAAUAUAUUGUCCUCAUGUUAGGGAAACCAACAUGAGGAUCACCCAUGUGAAUGGGUGGCAUAUUAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU.
4) However, the stamper tool pastes more than just the MS2 sequence.
Here are the sequences stamped if one were to click on the same base with the stamper tool repeatedly: 1st stamp=ACAUGAGGAUCACCCAUGU, 2nd = ACAUGAGCAUCAGCCAUGU, 3rd = ACACGAGGAUCACCCGUGU, 4th= ACAAGAGGAUCACCCUUGU, 5th= ACAGGAGGAUCACCCCUGU, 6th= ACCUGAGGAUCACCCAGGU, 7th= ACCUGAGGAACACCCAGGU, 8th= ACCUGAGGAUCACCCGGGU, 9th= ACCUGAGGAUCACCCUGGU, 10th= ACGUGAGGAUCACCCACGU, 11th= ACUUGAGGAUCACCCAAGU, and so on. Clicking incessantly the MS2 sequence will be stamped every 25th click or so [will say, “present in (1)” in the objective box].
That’s all I had time to do thus far, but hope to try out the rest of the puzzles later on.