FMN 1a - ON
In NuPACK with FMN bound in state 2 the guide sequence from nt 14-20 mispairs with nts 135-148
Yes, that’s seems to be the the typical symptom. By strengthening the desired folding, I can satisfy state 2 (complete with DNA binding) in NUPACK, but haven’t been able to satisfy both states at the same time.
NuPACK
FMN 1a - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGGAGGAUAUACAAAGAGUAUGAUGAUGAGAUGUAUUCAUCUCAUCAUCGUACUCAAACAUGAGGAUCACCCAUGUAGAAGGCCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 1b - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAAGAAGGUACAAAACAUGAGGAUCACCCAUGUAAGGCUAGAGUUAUGAAUUCAUAGCUCUAGCCAAUACAUAGUGAGGAUAUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 1b - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAGAAGGUAUAUAUUAAUUCUUAAGAUGUAGACUGUCUAUUGAUAGUCUACAUCAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 2 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUGUCAAACAUGAGGAUCACCCAUGUAAUGAAGGAUAUGAGUAUUCUCAGAAGGUCAUCAUGUUAUAAAUAAAUGAGAUAUAGACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
An admittedly ugly design, still with all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 2 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUCGCAUUUAUAACAUGAGGAUCACCCAUGUAGGAUAUGCGUAUUCGCAGAAGGACGUGGAAGUAGACUGAUUCAGUCUACAGCGAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 3 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAACAUGAGGAUAUGUGUAUUCACAGAAGGCAUAAGAUGAUGUAUUCAUCAUCAAUACAUGAGGAUCACCCAUGUUUUAUGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 3 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGCAAAUGUAGGAUAUCUGGAUUCAGAGAAGGACAUGAGGAUCACCCAUGUAAGACUAGAGAUGAUUCAUCUCUAGUCAAAUGCGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 4 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGGAGAGGUUGCUCAACAUGAGGAUCACCCAUGUAGGAAAGCCUUAGGCAUCAAGGAUAUCGUUUCUACGAGAAGGUGAGUACCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
NuPACK
FMN 4 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAAGAUGAUCGAGACUAUUGUCUCGAUCAUCAACAUGAGGAUCACCCAUGUAGGAUAUCAGGAUUCUGAGAAGGGCAUGAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
For NuPACK TEP 3 & 4 : having a hard time solving both On and OFF (with Vienna solving came quite easily)… I’ll keep trying
Thank you Andrew, for continuing to post these. Nando and I have discussed the issue, and he is going to experiment with tweaking the NUPACK parameters to see if it brings the predictions more in line with Vienna’s. But then, it may be NUPACK that better predicts what will actually happen in the lab. In either case, your solutions will be an important part of making that judgement call.
Thanks Nando
Status on the NUPACK issue: Nando has confirmed that NUPACK is doing something wonky on the CRISPR puzzles. He has experimented with the NUPACK-specific puzzle definitions (which account for why you may find that sequences you posted yesterday are folding differently in NUPACK today), and that doesn’t seem to fix things. But he hasn’t given up yet.
NuPACK TEP 3 & 4
still not able to solve either On or OFF… offcourse I’m not that experienced nor systematic (yet)…
Also, behavior of folding seems erratic with small mutations, not sure how to describe what I’m seeing: folding jumps all over the place, smaller molecule often falls off in state 2 when other restraints are being met…
Fun to see differences between engines though and great to be able to look at these lab candidates already (much needed good practice)
Great news! Nando found and fixed a bug in the NUPACK-specific code. Here’s a slight mod to Andrew’s solution for FMN 4 - ON that works for all three folding engines:
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGGAGAGGUUGCUCAACAUGAGGAUCACCCAUGUAGGAAAGCCUUAGGCAUCAGAAGGCGCGUUUCUGCGAGGAUAUGAGUACCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
You will probably need to flush your browser cache to get everything up to date.
I suspect and hope that it won’t be difficult to get NUPACK solutions now. But for a thorough test, it would be a relief if we could get confirmation that every puzzle has a NUPACK solution now. Even better would be a solution for each puzzle that satisfies all three folding engines, but that’s not necessary. So if you keep testing and posting, Eli and I will continue to keep the spreadsheet up to date.
Ah! There’s been another change in some of the FMN puzzles. Eli brought our attention to the fact that past experimental results have strongly indicated that rotating the FMN aptamer in FMN puzzles 2-4 would be beneficial. So that change is also made, and explains why past solutions to those puzzles will now fail.
One more thing – If you’ve already worked on an FMN puzzle that has been changed, you’ll also need to reset the puzzle, in addition to clearing the browser cache.
ok.
FMN 1a - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGCAGGAUAUGAGUUCACAUGAGGAUCACCCAUGUAAAACCUUUAGUUGGAGAUUCUCCGACUAAGGUUGAUCUUCAGAAGGGCGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
FMN 1a - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGAAGGAUAUGCAAGGAGUAUGAUGAUGAGAUGUAUUCAUCUCAUCAUCGUACUCAAACAUGAGGAUCACCCAUGUAGAAGGUCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Is there a new link to the updated Fmn CRISPR puzzles or does deleting eterna flash take care of it?
I had to delete my browser cookies Astro, I’m using chrome.
FMN 1b - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAAGAAGGUACAAAACAUGAGGAUCACCCAUGUGAAGAAUAGAGUUAUGAAUUCAUAGCUCUAUGGUUACAUAGUGAGGAUAUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
FMN 1b - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAGAAGGUAUAUAUUAAUUCUUAAGAUGUAGACUGUCUAUUGAUAGUCUACAUCAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.