Also, when you finish with a lab and hit the back button, instead of taking you to the whole list of labs, it takes you to the color chart and no back button there. You have to select labs from top menu all over again. Then scroll down to find next lab. The whole situation is very time consuming. Finding myself doing sight-unseen voting just to meet deadline. Also lazy mods.
Yes, I now see what Wateronthemoon says. I choosed the Old lab browser. But all the time I get sent back to the new and has to start all over. It is very tedious. Here is what happens in step:
1: I found the design I want to look at. I want to go back to the design list with the person button as usual.
- Now a new window opens and forces me back in the new UI.
I have discovered two things.
1). when you click on the lab design you get to see the “target shape” which is colored supposedly representing the proper nucleotides but it seems that the colors are not correct.
2). when using the “my votes” column it only works when you are currently voting. If you made three votes and decided to go back later to finish voting the previous three votes are not shown.
COMMENTS ON THE NEXT/PREVIEW INTERFACE
I think this interface will work fine for a preview. But we need to be able to call it when we need it and not have it pop up each time we click a design and have it get in the way.
Though it is meant for short cut to make voting easier, it doesn’t work as such. (All honor for the intention) I’m loosing a lot of information, like the ability to see estimate mode, if the design is folding in the energy model, temperature, dotplot, free energy and score. Worst of all I can’t see continuous SHAPE data - as I will also want this one click way to see and analyze designs that we have results for.
I want the next/previous button to be in the design itself, just as Mat suggested with his image mockups. I want the full screen for viewing and I will want the fine game view of the design.
SUGGESTIONS FOR A BETTER UI
Quote by Zanna: As long as I can see everything with one click, Im happy 
I have made a few crude pics to demonstrate what I mean.
Voting and designing interface.
Lab result interface
The above pics are rip offs from Mat’s mockups.
I wish that one could choose what modules one want shown. There could be melt module, dot module, temp module, author/title module. So one get exactly what one needs and nothing more.
I have added chat log from yesterday and today as they hold useful suggestions to what could be improved in the new UI and how.
(8 Nov 2013)
Brourd: Wateronthemoon, are you still on? [1:06 AM]
RedSpah: apparently no [1:07 AM]
RedSpah: hi Brourd [1:07 AM]
Brourd: I was just going to say, that they have the ability to vote in the new browser [1:08 AM]
Brourd: albeit, in a relatively awkward place. [1:08 AM]
Zanna: but you can’t view it first from there [1:09 AM]
Zanna: I just get blue screen [1:10 AM]
Brourd: in the new browser, you should get the list of designs [1:10 AM]
Zanna: yes, I do [1:10 AM]
Brourd: http://prntscr.com/22ulxg [1:11 AM]
Brourd: then, when you click on a design [1:11 AM]
Brourd: http://prntscr.com/22um25 [1:11 AM]
Brourd: this should pop up [1:11 AM]
Brourd: then [1:11 AM]
Brourd: http://prntscr.com/22um7o [1:12 AM]
Brourd: scroll down, and you should see vote at the bottom [1:12 AM]
Zanna: yes, you can’t see the dot plot and melt [1:12 AM]
Brourd: What do I look like, a magician? 
[1:13 AM]
Zanna: lol [1:13 AM]
Brourd: Actually, I think that would be an interesting way to do things. [1:13 AM]
Zanna: it was the dot plot I was really wanting to see [1:13 AM]
Brourd: Yeah, yeah 
[1:13 AM]
steven123505: lol [1:13 AM]
steven123505: hey B [1:13 AM]
Brourd: what we could maybe lobby for [1:14 AM]
Zanna: lobby for what? [1:14 AM]
Zanna: exactly? [1:14 AM]
Brourd: http://prntscr.com/22umxm [1:15 AM]
Brourd: fill in this empty space with the dot and melt plot [1:15 AM]
Brourd: If they can anyway. [1:15 AM]
Zanna: ah [1:16 AM]
Zanna: good idea [1:16 AM]
Brourd: Maybe with better dot and melt plots 
[1:16 AM]
Zanna: but another problem… [1:16 AM]
Brourd: We can move vote button up higher [1:17 AM]
Zanna: I can’t see how many votes the design already has from there [1:17 AM]
Zanna: need to see that also [1:17 AM]
Brourd: We could maybe also try to do that [1:17 AM]
Brourd: What do you think zanna? [1:17 AM]
Brourd: What that be good with you [1:17 AM]
Zanna: as long as I can see everything with one click, Im happy [1:18 AM]
(9 Nov 2013)
Hyphema: it seems much harder to vote on labs [1:13 AM]
steven123505: yeah [1:14 AM]
steven123505: but voting for my labs is easier ;D [1:15 AM]
steven123505: you should try it [1:15 AM]
Hyphema: also. when you click on a design to look at…the “target shape” shown has what appears to be a colored structure representing all the nt’s used but the colors do not make any sense [1:15 AM]
Hyphema: : D [1:15 AM]
steven123505: didn’t notice that [1:15 AM]
mat747: i agree with hyphema [1:17 AM]
Hyphema: i really like the idea [1:18 AM]
Hyphema: just the execution is bit off. [1:18 AM]
mat747: it would be great if we had “prev” and “next” in the lab design screen [3:50 PM]
steven123505: agreed [3:51 PM]
Eli Fisker: Yes, I would want it in the design itself [3:51 PM]
mat747: https://getsatisfaction.com/eternagam… [3:51 PM]
Eli Fisker: It will both look better, but we wouldn’t lose all the information we are now losing [3:52 PM]
Eli Fisker: Like melt temp, Total energy, continuous shape data and yada yada [3:52 PM]
Eli Fisker: I will like something like this: [3:53 PM]
Eli Fisker: https://getsatisfaction.com/eternagam… [3:53 PM]
Eli Fisker: To stay in the design and still be able to click next [3:53 PM]
Eli Fisker: or previous [3:53 PM]
Eli Fisker: but still get all the information [3:54 PM]
Eli Fisker: and preferable have both shape data and base colored shape beside each other [3:54 PM]
Eli Fisker: And then I could use the lab list to narrow down what designs I want to look through. So I don’t have to go through all by default, but can carefully pre-pick which I want to view. From things like energy range, number of GC-pairs and so on. [3:56 PM]
I post a problem, but looks like this is a better place for it.
https://getsatisfaction.com/eternagam…
^ link to my post.
Zanna–I really like your graphic above showing dotplot and melt nice and big next to the design. That’s just what i’d like, so you don’t have to keep enlarging it to check each time you make a change.
In the new list (i keep call it “color chart”) i noticed order is by number of votes, with most votes at the top. Not sure i like this.
Also noticed, like Hyphema, that in the new popup screen showing the shape colors are off–like where tetraloop is all locked yellow, this shows a green or a blue in the middle.
Anyway, glad we got an extension–makes my inner (and outer) procrastinator happy.
In the ‘Previous labs’ tab, I’d really like a new sorting option to be ‘by Cloud Lab Round’, and it should be the default one in my humble opinion.
Many thanks, everybody! I have drawn issues from this thread, and in-game chats to create a specification we can present at this Wednesday’s dev chat 2013.11.13 (6pm eastern).
Fine piece of work you did there. Thx!
I very much agree. When trying to find the latest labs, they are scattered all over the latest pages, depending on their proposal date, which can be a while back.
Script search field
An FYI
search field is buggy.
search by JR gives one page but I have more than one page.
search by jandersonlee give nothing but when i remove name and hit enter his
list come up. seems no way to reset so have to reload list from start
any better place to list these other than forum?
not really “forum worthy” but no other place to post.
Lib.energyOfStruct(seq.join(’’), structure)
Just an FYI - these two structures throw an error when run through the
above function:
ACACGUGGCUGCAAAGUGGACUGCGUGCAGGUGGGUGCAAAGUGCACUGCCUGGCAAAGCGCACGUGCAAAGUGCGGGGCAAGCGGGCAG
.((((…((…(…)…).)…))))((((…((…(…)…).)…))))((…((((.((…(…)…))…))…))…)).
AGGGAAAAACCGCGGGCGGGGCGAAAAAGGCCGGGCGGCCCGAAAAAGGAG
.((…))((.(.(.((.(…).)).).).))((…)).
I just trap the error so no big deal.
It works for all other.
Hi Hyphema,
Thanks for reporting.
With respect to first issue, it would be helpful if you could give us some links!
Thanks,
Diana
I have been wondering about why there was a tendency for the lowest scoring data to most often be those who were pushed and spread out compared to the rest of the data. I think I know why. It is due to the added red frame from the error data. It works as an extra size add on, where it should be fit to the frame of the standard size of the letter box.
Failed designs land on top when I sort after score and rank the designs from highest score and down.
browser back button not working in previous labs
You have a lab list, a lab, and a lab design.
browser back button between lab list and a lab only works if you don’t view a lab design.
if a lab design is viewed you get stuck in a loop between the lab and the lab design.
structure is found in lab info tab and sequence is found in review tab.
difficult to get from one to other to get both
(unless I am missing it in lab design list page)
unable to find switch labs in previous labs.
(this could be me again)
lab download file:
might add header to csv download file with lab#,url and structure so all in one place.