Switch puzzle idea

Feedback Feature Suggestions
1

I have an idea for a switch puzzle, I don’t know if you’ve tried this before or not: can there be a fixed part? I’ve made a simple one I call Simple Key, here’s the shape and sequence:

 .......(((((.....(((((......((((....)))).....))))).....)))))........................ 
 GGAAAUACCUCUAAAAUUCGGAAGGAUAUUAUGAAAAUAAGAAGGUCUGAACCUAAGAGGAGGUAAAGAAACAACAACAACAAC

This is the bound shape notation with the FMN loop. The sequence will form bonds where it’s supposed to (and the FMN loop), but will misfold into a stronger shape instead with a multiloop where the bonding site is. Here’s the misfold shape (unbound target):

 .....(((((((...((((....)))).((((....))))..((((....))))....)))))))...................

Obviously you can refine the shape as you see fit, the idea is to have a part that’s not shifting, and the bonding site is an ideal splitting spot.

2

Hi drake178,

This looks like a great puzzle - can we make it as one of the switch challenge?

Eterna team

3

That was the intention, yes, but I thought you might want to tweak it. Thanks! :smiley:

Edit: I looked again at that solution and it should probably not work because it has a loop opening up with an A-U, which is something I’ve seen happen in switches (bound form), but I don’t yet know why it happens. Anyway, I re-solved it with a slightly different sequence:

 GGAAAUACCUCUAAAAUUCGCUAGGAUAUUAUGAAAAUAAGAAGGAGUGAUCCUAAGAGGAGGUAAAGAAACAACAACAACAAC
4

There’s at least one thing you’ll have to tweak, the hook needs to be 1 base longer because right now base #65 will be locked in the hook but it’s also in a pair in the unbound shape.