Area to submit design for discussion?

I sent Eli a Lab design that I was excited about.  He returned very useful comments.  I think an area where people could submit Lab designs they think are interesting and then receive comments from others would:

1.  Be very helpful for Lab participants
2.  Be a good way to all get on same page with pattern descriptions
3.  Helpful for all to see different ways people are looking at lab patterns
4.  Be a way for group to bring out what they thought was most interesting.

3 Likes

Gerry, I would love to participate in this kind of discussion.  Currently, I think here in the forums is the best venue we have.

Having said that, I’ll be travelling to Eternacon and beyond for the next 5 days, and my participation will probably be limited by circumstances during that period.

COMPARISON #1

Below are two designs in State 1 from TEP 1a Exclusion to comment on.  

The first is one by Omei with the MS2 on the far right with a fixed stem in the middle.

I like this design because the large fixed stem makes the movement to State 2 very efficient and the MS2 dissipates completely and is right next to the end (which I think Eli likes…and whatever he likes so do I!).  You can use the link below to see.

http://www.eternagame.org/game/browse/8047744/?filter1=Id&filter1_arg1=8324282&filter1_arg2=8324282

The second design is one of mine with the fixed stem at the far left and the MS2 right next to that.
The MS2 dissipates completely but only connects with one side of  the molecule. - while Omei’s splits in two and connects to both sides of the molecule.

http://www.eternagame.org/game/browse/8047744/?filter1=Id&filter1_arg1=8333732&filter1_arg2=8333732

Please share your views on how would you compare these two designs? 
And what is your level of confidence in your opinions?

1 Like

Thank you, Gerry!

First, let me review my own.  It is not a design I actually expect to score especially well on fold change, for two reasons.

On this round I am doing a lot of testing of how multiloops that do or don’t have adjacent stems effect the fold change.  The rationale behind this is that there is significant evidence suggesting that if nothing gets in their way, adjacent stems in a multiloop will line up coaxially, and that in turn will lower the energy of the folding.  The Turner energy model says that the energy of this “nicked stack” (“nicked” because one side of the combined stack doesn’t have a continuous backbone) is approximately the same as if the combined stack had a continuous backbone.  We also know, from both inspection of the code and observing the results, that neither Vienna nor NUPACK follows this aspect of the Turner energy model.  Thus, I expect that the presence of adjacent multiloop stacks will lower the actual energy to be significantly lower than the prediction for that folding.  Plus, if the other state doesn’t form the same adjacent stacks, it will have no effect on the energy of the other state.  So in a sense, I expect it to be a way to lower the energy of one state (in a way not predicted by the folding engines), without having any offsetting effect on the other state.

To use this putative effect to increase the fold change, the state with the adjacent stacks should be the ON state.  But for whatever reason, I labelled this puzzle series as #CoaxialStacking in the ON state, instead of the OFF state, as it should have been labelled.  So in fact, I expect the effect here will be to lower, not increase, the fold change.

I think I’ll post my second recent separately, since it may take me awhile to prepare the graphic.

1 Like

But while I’m on the topic of the effect of coaxial stacking within multiloops, let me comment on your design.

Your design also has adjacent stacks in the OFF state.  But unlike mine, it has three adjacent stacks in the ON state.  I have no basis for guessing whether a third adjacent stack increases or decrease the stacking energy over just two.  Certainly all three can form a perfect stacking shape; there’s just not enough room for that in three dimensions.  So it is not going to be as low as two pairs of consecutive stacks.  However I do strong suspect that shifting things so that there was at least one unpaired base (in both states) between bases 102 and 103 would improve the fold change.  This would reduce or eliminate the stacking bonus in state 2, while giving state 1 an evidence-based good configuration.

1 Like

The second thing I like to do when evaluating a design (but to be honest, I rarely do when submitting designs) is to look closely at the dot plot.  In contrast to an MFE folding, which shows the single folding that the energy model predicts the RNA will be in more often than any other, the dot plot gives a (higher level) picture of all the various foldings that the RNA is transitioning between.


Here’s the state 1 dot plot for my design.  The dark dots in the cyan circle indicate that the MS2 hairpin is expected to form most of the time.  The area inside the two blue and two brown rectangles contain pairings that will be competing with the formation of the hairpin.  There is one stem that is competing against the hairpin, which I have marked in green.  Checking the coordinates, I see that this is a stem that I want to form in state 2.  A thermodynamically optimal switch would never have this alternate stem forming in state 1, so the folding engine is predicting that this will not be a thermodynamically perfect design.  On the other hand, I know from experience that Eterna’s grey-scale rendering of the dot plot makes low-probabilty pairings look more significant than the actual numbers suggest, so I don’t judge this to be a significant defect.

Here’s the dot plot for your design.


Your design has more competition for the hairpin.  Again, they are not high-probability competition, but I would still judge my design to be a little more promising on this criterion.

I should mention that my experience (and I believe jandersonlee, who has also studied partition functions closely, concurs) is that the dot plot is not a very powerful tool for identifying really good switch designs.  But it is significantly better at highlighting “defects” that make for mediocre switches.

1 Like

Finally, I’ll make one more comment on your design.

Here, I have marked 5 bases that are unpaired in both states.  At least one of these bases has to be there in state 1, to achieve the minimum sized 3-loop.  But the other four bases don’t have any obvious role.  My experience suggests that in general, bases that don’t have a specific purpose are best tied up in a static stem rather than left “flapping around”, where they are more likely to cause unwanted effects than wanted effects.

However, given that of all RNA structures, the energy associated with multiloops is probably the least well understood, I think it is great that you are submitting lots of mutations for these bases.  There’s a good chance that there will be one or more significant outliers that will be very interesting to look at in more detail. 

Here’s to science exploration!

1 Like

I am blown away by the helpfulness of your comments.  Wow…

Our Lab entries and energy can benefit so much from going through this prism.

And with the mutation and shifter tools you have created, this work is so much more accessible and fun.  Thanks so much Omei.

Thank you, Gerry.  But I want to stress that I am as puzzled about the nuances of RNA as anyone else here.  These are just my current thoughts on issues that are far from settled.  I hope that in a year or two I can look back and marvel at how naive I was when I wrote the above.

What are your thoughts on these two designs?

After 7 months in eterna, my design observations are general and disparate.

 Almost all my initial Lab submissions relied more on randomness than thoughtful pattern application.  Watching the RNA change states and seeing the near infinite number of possibilities coupled with having no framework to create or test left me feeling clueless to say the least.

 But that’s how I also felt when I first started single state puzzles.  And even though Labs embody so much more uncertainty than puzzles, there always seem to be findable patterns in life.  And having felt such support to develop inquiry within eterna, I searched and found your Lab pattern discussions with Eli.  So enheartening but so humbling too.

 There were also other sources of that humility.  I had spent over a year getting the top results in Quantum Moves, another citizen science game.  After mentioning it to Eli, he played it for a few days.  Not only did he pass my scores on a number of games within those few days, but the way he was able to see and express the patterns was astounding to me.

 Eterna’s design and scoring is not aligned with its research goals.  So attention/energy has bifurcated.  Yet the community’s underlying research desire creates so much resilience.  

 This all connects to a passage from a course I’m taking on seeing as an artist called “The Right Eyes: Rilke on Painting” by Lena Levin.  Rilke writes to his wife about a Cezannne painting saying:

 “Everything that was rearranges itself, lines up in formation, as if someone were standing there giving orders; and whatever is present is utterly and urgently present, as if prostrate on its knees and praying for you …”   Rainer Maria Rilke to Clara Rilke

Here “praying” means hoping strongly for a particular outcome.  Doesn’t that sound just like what CRISPR wants for eterna?

Gerry

1 Like

Evaluation #1

Open for Comment:  Below is another design from same Tep 1b Exclusion.

I chose it because it’s different and I don’t know why it wouldn’t be a good design (which reflects my lack of previous Lab analysis).

1.  The MS2 is crowded onto the aptamer gate  (I think I’m phrasing that right…).  Is this a no-no or an efficient design?..

2  The MS2 splits completely in state 2.

3.  Design has a large fixed stem 48-76.

4.  has few dangling NT’s.

5.  Seems to move between state efficiently.

thanks Gerry

http://www.eternagame.org/game/browse/8047745/?filter1=Id&filter1_arg1=8355609&filter1_arg2=8355609

1 Like

Hi Gerry!

I love your initiative with putting up a specific lab design analysis space up in the forum.

  1. You say that “The MS2 is crowded onto the aptamer gate”

This is generally a very successful approach for Exclusion labs. So that shouldn’t be a problem.

Another thing I notice in your design is magnet segments. Islands of G’s and C’s. And several of them. These are often present in good switches. They help the design swap securely between states.

The weaker bases like A and U help things glide. As a note of oddity, there generally seems to be lot higher percentage of U’s in designs that uses the full switching area. Full moving switches without static stems. In particularly if the designs are not in s a switch bubble and don’t have a neck. (A closing stem).

Magnet segments highlighted

There are two sets in state 1 and 3 sets in state 2.

Also one of the magnetsets - the one with 3 C’s is doing an overlap. Not exactly matching up between the states. This is neither good or bad, just interesting.

Not each magnet set has a partner.

Normally I would say that having a small stem forming in front of the MS2 is less effective. One shouldn’t make it too strong.

But what you have there is short and the bases are useful to the rest of the puzzle.

Also I have seen working designs that has such a stem. I usually call it a MS2 Gate - because it is there when the MS2 hairpin forms and is ON.

So please go on trying out this approach.

Just like the aptamer gate is the stem forming infront of the aptamer when it is ON.

I haven’t adressed everything. Just taken what stands out to me.

I have crossed fingers for your design.

Design Proposal

A way to test if this design type has a way of working is to add variation in. Besides mutating it.

One way to do this is to swap in alternative MS2’s for the one you already have.

Note that will take changing a bit in the surroundings of the MS2 too. Take note which bases the MS2 pairs with and which of them are changing in the alternative MS2. Then change the bases to match the alternative MS2.

Here is an example with an alternative MS2 in your design:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCACGUACAUUGUGUCGAUAAGACACGAUGUACGUGGUAGGUGCUACAUGAGCAUCAGCCAUGUGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

Afterthought

Extra General question: I wonder if we can make Exclusion switches that work but have their MS2 somewhere not entirely close to the aptamer? I am particularly curious to see if this is possible now we have gotten labs that are bigger in size.

For me two things stand out as being interesting about this design.

  1. As you called out, the MS2 overlaps with the base that hold the aptamer together. Looking just at the secondary structure of the RNA, this makes perfect sense for an exclusion puzzle. But in the experiment for state 2, there will also be the large MS2 protein and the small FMN molecule trying to bind to the RNA.  Potentially, they could be competing for the same volume in three dimensions, reinforcing the exclusion.  But it is also possible that there could be a very nice fit among the three of them, to the extent that this design actually acts as a Same State design., i.e., it’s fold change will be reported as being less than 1.  This is the kind of question that makes lab analysis fun!

  2. The triloop configuration, which you didn’t mention, is also interesting.  Adjacent helixes tend to align along the same axis, essentially forming one long helix.  This results in a lower free energy, which lowers the experimental KD value, which in turn should increase the fold change of an Exclusion puzzle. But here, we have three possible stacking alignments, only one of which can be forming at any time.  What is the net result?  I don’t know.  Maybe this is the round where we’ll get enough examples, along with relevant mutations, that we can figure that out.

Comparison # 2

Below are 2 designs from TEP 2 Exclusion.  The 2nd is just a modification of the first where I tried to reduce the size of the inner loop.  So my main question is “does reducing the inner loop help?”

I’ve circled the same fixed stems in each design and the MS2 is highlighted (although hard to see in state2).  In Design #1, the longer fixed stem has 1 additional pair than Design #2.

Design #1

http://www.eternagame.org/game/browse/8047746/?filter1=Id&filter1_arg1=8260471&filter1_arg2=8260471

Design #2

http://www.eternagame.org/game/browse/8047746/?filter1=Id&filter1_arg1=8381368&filter1_arg2=8381368

In State 1, Design#1’s inner loop has 21 unpaired nt’s.  Design#2 has 13.

In State 2, Design#1’s inner loop has 14 unpaired nt’s.  Design#2 has only 4.

Does the extra pairing in Design#2 help? 
Or does crowding in the smaller loop in design#2 create instability?

thanks,

Gerry 

A different question that might be asked with the above design is: Does invariant stems help or hinder a designs success? 

What do you mean by invariant stems?

I think it means a static stem that stays the same in all states.

when there is a multiloop, I have used a static stem to reduce the size of the loop. I think it will shorten the distance from an MS2 to an aptamer, making it easier to attract each other.  Just a hypothesis :slight_smile:

2 Likes

I had not thought of that.  Very helpful thesis.  Thank you.

Vienna and Vienna2 treat those two structures somewhat differently: it’s hard to know which structure is ‘correct’; or even if the notion of correctness really applies given how RNA flops around. I suggest submitting solutions and let nature be the judge.