The new puzzle progression is now live! We’re still working on a few things, but we’d really love your feedback on the latest iteration. Please post feedback, bug reports and any other concerns here
If you experience technical problems with any of the puzzles or with the site you can contact Caleb directly at calebgeniesse [at] gmail [dot] com. For bug reports, but as specific as possible (browser information and screenshots are helpful).
I’m not seeing a clear way to navigate in-site to the new tutorial puzzles when I’m logged in as myself. LFP6 suggested they’re on the main page, but I couldn’t figure out how to navigate there either. The eterna logo points to the lab page. Turns out though that “Lab Bench” (which I assumed would be the lab page based on its name) points to the main page :D Anyway, just pointing it out. Also, I seem unable to get to any messages older than the four most recent. Just getting an animated loading icon when I click “more messages”
Nice to see the site making some changes 
edit: also, nothing happens when I click on the green “1” button that says “nucleotide mixer” on mouseover
also, when I reload or refresh the page of one of the new puzzle progression puzzles, I’m taked back to the first one with no option to skip through or speed back along to the puzzle I left off at
Looks like player puzzles with long titles are able to push the puzzle shave preview thumbnail below the bounds of the white box they’re supposed to remain in, encroaching on puzzles listed in the row below
This doesn’t look quite right - not even sure if it is supposed to be there http://i.imgur.com/2hYaNM9.png
Formatting on arrows in the front page is broken http://prntscr.com/a2h79n - I think it’s Windows when it should be UTF-8.
The title over the tutorial puzzles is “Try Out The New Puzzle Progression”. Shouldn’t this be something more appropriate for a new user coming in?
I have to reduce the screen size to 50 or 75% to get to the “next puzzle” button on most but not all puzzles. when I shrink the size down I cant see the energy in the total energy box so I have to increase the screen to 100% then shrink back down to get to the next button. So far I like the progression
I’ve solved all constraints for supercomputer level 4, but there is no indication I’ve completed it nor any options for moving on to the next puzzle in the set http://i.imgur.com/mVFd5Hu.png
Same as you, Hoglahoo
cannot solve supercomputer level 4
ACAUGAACAUGAGACAUGAGGAUCACCCAUGUGUACAUGAGGAUCACCCAUGUACAUGAGGAUCACCCAUGUUGAGGAUCACCCA is my solution that meets all constraints
MS2 @35-53
when I am solving puzzles under the “play for fun” I cannot navigate away from the page without having to open a new tab. pic shows the navigation bar up top is missing http://prntscr.com/a2j8de
under thermocycler, I think level 5 should be after level 9 to explain the natural vs target mode switch since it is solved similarly. (I think level 5 is similar but I may be wrong, going by memory) still like the progression very much.
Hi as i see bugs or improvements needed I’ll post them here thanks>>> I have to deselect then re-select in game chat option for it to open every time i get to the next puzzle!! Thanks!!!
Also this>>>http://prntscr.com/a2lhqy
Me too.
Same as you, Hoglahoo
cannot solve supercomputer level 4
ACAUGAACAUGAGACAUGAGGAUCACCCAUGUGUACAUGAGGAUCACCCAUGUACAUGAGGAUCACCCAUGUUGAGGAUCACCCA is my solution that meets all constraints
MS2 @35-53
From the home page(…org/web) when I select “just for fun” under side projects, I’m brought to the first puzzle. The home page button said I had 0% completed. I actually have many puzzles completed. I have to go through each puzzle again each time I come back to “just for fun”.
Each puzzle has all the bases mutated so all I have to do is change from Target to Natural and I get bubbles so I can continue to the next already solved puzzle:( In the old format, we had boxes we could check-mark so we could see “All” or “solved” or “Unsolved” if I remember correctly.
Seems like the software is stuck on “All” when we restart the “Just for fun” project?
still does not work
http://www.eternagame.org/game/puzzle/6502963/ is too large for my monitor. Puzzles before this one were sized OK. New players will have to know how to resize their browser in order to see the selection button at the bottom of the page because the page doesn’t scroll.
Same as you whbob, only that it keeps returning to http://www.eternagame.org/web/puzzle/4350940/ and the 0% completed sign remains at 0%.
I am mistaken, Astromon’s pic shows the issue with level 5 on thermocycler. The information box should say switch between natural and target modes.
Astromon, thank you, your pic shows the issue with level 5 thermocycler.
http://www.eternagame.org/game/puzzle/6502974/ froze on me at 9:00 EST. 
Again, I have to start over from puzzle No. 1 
