Partial puzzle of Prevotella Albensis

Gameplay and Strategies
1

Could someone please post a puzzle of a part of Prevotella Albensis?
If we could get that partial puzzle stable (especially the pair in red) then we could use it as a starting point for the complete Prevotella.

2

That’s also where I’m stuck

3

Yep, I’m stuck here too.

4

The dev team is reviewing this puzzle. We will let you know the outcome.

5

it haunts my dreeeeaams @_@

6

Well, no matter what I do I end up breaking basepairs at the marked places. I have tried loop energy optimisation and whatnot.

Is it possible to solve this one?
Have the devs managed to fold this one correctly - ever?

I’m sure it must be som loop optimisation that eventually will make it solvable, if it can be solved.

7

I forgot to show the state where the basepair you wanted to fuse are sticking together.

I have put the pattern mode to the left and the natural mode to the right in the image below.

But I’m unable to make the other marked basepairs (in the image in my previous post) stick together. It would be nice if the one who solves this one could post an image where the whole region is stable, either here or by e-mail :slight_smile:

8

None of the highest ranking players have managed to fold this one yet.

Could the developer team please comment on this?

Are you sure that Prevotella albensis can be folded into target mode?
Are you sure the target mode setup is correct?

Maybe the folding algorithm has flaws that makes the energy configuration in the problem area wrong?

9

I think that most of us holding ranks in the top 50 know the effect of stabilizing loops (and 0 players have solved even the Level 0), but my questions were:

  1. Are you sure that Prevotella albensis can be folded into target mode?

  2. Are you sure the target mode setup is correct?

  3. Could the folding algorithm contain flaws that makes the energy configuration in the problem area wrong?

10

I realized level 3 of Symbiotic plasmid is 1 nucleotid longer (the first one) than the other levels. Maybe something similar happened to Prevotella?

11

I have asked whether the devs have tested that it is possible to fold P.Albensis but they ignore the question. Recently the problem section of that RNA was released as a separate puzzle. I will not try this puzzle further unless the devs confirm that it is solvable after having folded it correctly themselves, or some of you fellow puzzle-solvers manage to solve any of the P.Albensis puzzles. Why bother?

Here’s one dead end:
GUUUAAAAAAAACAAAGGGAACAUGUGAAUGAAACGCGUUGGAAAGAUGAAAAAAAUCAAAAUAUAGAAAUAUAUAAAUUGGCUUGCCGA

Here’s another:
GUUUGAAAAAAACAAAAGGAACAUGUGAAUGAAACGCGUUGGAAAGAUGAAAAAAAUCAAAAUAUAGAAAUAUAUAAAUUGGCUUGCCGA

12

I tried the partial, no better than the whole, still doesn’t solve, and I see nobody else has solved it either after a day or so.

13

Got about 4 different strings for the partial puzzle that all fail on that problem bond in the OP :confused:

You’d think at least one person would have stumbled upon the solution by now if there was one, wouldn’t you?

14

Hi all,

I am fairly new here, and when I mentioned I was attempting this one, I was advised by some of the top players that this one was impossible and to only give it an hour of thought before moving on.

With about that time I have managed to get to to the point of only 1 pair not quite right (as I am sure others also have) but thought I would post it here since the currently posted diagrams aren’t quite that close. (and to hopefully prompt further feedback from the dev team)

16

If you solve how to keep those two nucletides together I will be utterly impressed :slight_smile:

17

This is a simplified version of the Prevotella Albensis Experiment 1 puzzle. It uses the same basic ‘apparently unsolvable’ shape as the other Prevotella Albensis puzzles.

If you simplify it to the problem area, the loop (starting at 7)'s size makes the pairs at (5,21),(6,20), and (14,19) mutually unstable. I didn’t explore too much so a few other factors could make those pairs unstable as well, but the shape was able to be stabilized with a 5 nucleotide loop.

Left Shape notation: …((…(…)))…
Right Shape notation: …((…(…)))…

18

Maybe as a stepwise process, we can compete for the lowest energy difference between the natural and target modes. I have it down to 4.3kcal. If no-one has better I’ll post some of my sequence here

19

make that difference 3.2