Please review the proposed puzzles for the initial OpenCRISPR round

Thx Astromon!

Player Zama also pointed out to me that data in the specs and broswer tables are not correlating (melting points and free energy from what I’ve checked). Apparently it’s not for all puzzles, but it is for a lot. What do experts think of this?

1 Like

Eli, can you elaborate on the specific symmetry you are referring to here?

Omei, I see what happened.

This was one of my designs that looked good in the engine when I posted it, but got unstable.

I can see the design as I intended it when I open this lab page

https://www.eternagame.org/game/puzzle/8038691/

And paste in my sequence:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGUAGGAUAUGUAGGAUAUUCCUAAAAUAAAUUCCUACAUGAGGAUCACCCAUGUUCGCAAUAAUGGAAGAAGGACAGAAGGACGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

I shot an image as proof.

So basically it’s like the switching area in the two states, doing a cross over with each other. Just like in the blueprint idea. It is doing the exact same Origamy style fold, that I see pop up again and again in the riboswitch on a chip labs. In particular in Same State designs.

It’s probably that the folding engine in the specs screen (99% sure it’s the one you choose in the puzzle) isn’t the same as in the lab/data browser. Can you test for the 2 other folding engines?
Also, if you substruct the red part (I think you need to add it, but if I’m wrong it would work), the puzzle energy seems to be the same as the specs one: -56.89-26.80=-83.69~=-83.9, although I doubt it would round -83.7 to -83.9, so maybe I just picked the pair of nubmers that looks like it could match in the not-so-small group that doesn’t work? not sure.

After reading a bit, I think it’s the same as Eli’s problem above (not directly above, the one after)

Could it be related to poll’s problem below?

@Eli I’m not clear on what you discovered.  That you were mistaken, or that you have a reproducible scenario that demonstrates a bug?  If the latter, could you give the steps to reproduce it?

The engines give NuPACK: -56.48(26.80), -64.79(26.80); Vienna2: -53.68(26.80), -64.39(26.80). Don’t know how the browser table is coming up with -77.41 kcal. And there’s 20 degrees difference in the melting points.
Now also the pairing probability plot goes missing when I change engine, and the melt plot remains the same for all engines.

Bug report

  1. http://www.eternagame.org/game/browse/8038691/?filter1_arg1=8069544&filter1_arg2=8069544&fil…

Design is unstable when opened through lab. Unstable in all 3 engines.

  1. I copy out the sequence from there:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGUAGGAUAUGUAGGAUAUUCCUAAAAUAAAUUCCUACAUGAGGAUCACCCAUGUUCGCAAUAAUGGAAGAAGGACAGAAGGACGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

  1. I open the lab from the FMN lab overview page. Link to the lab:

https://www.eternagame.org/game/puzzle/8038691/

  1. I paste in the sequence in the puzzle.

  2. The puzzle is suddenly stable in Vienna and Vienna2

Specification for stable version

  1. The specifications like MeltPlot don’t match up for the stable and unstable version. This may be related to what Poll na gColm and MasterStormer has brought up too.

Specification for unstable version

 

Even More symmetry…

Continuation of my symmetry musings above. Omei was right, I was both doing bug reporting and speculating about symmetry at the same time.

"So basically it’s like the switching area in the two states, doing a cross over with each other. Just like in the blueprint idea. It is doing the exact same Origamy style fold_, that I see pop up again and again in the riboswitch on a chip labs. In particular in Same State designs."_

However as our design space get bigger it might not be the most effective doing a two stem cross over with 4 strands swapping partner between the two states.

3-way Stem Switch

There are other ways to achieve even more switch symmetry across axes. I have had fun doing a 3 stem switch, where 6 strands swap partner between two states.


https://drive.google.com/open?id=0BxJGPGrJ3fkKU0NPelhTVTNEQnc

This one still builds on repeat sequences that seems to be particularly helpful in making a switch happen. Stretches of pyrimidines (C and U) pairing with stretches of purine. (G and A)

4-way Stem Switch

I did try out make a 4 stem swap where all 4 stems were to swap partner with its neighbour.


https://drive.google.com/open?id=0BxJGPGrJ3fkKU0NPelhTVTNEQnc

Symmetry challenge

So far I have had no luck. Or rather, I found my 3-way switch while attepmting a 4-way switch. Perhaps one of you guys will have better luck?

Here are a few of my attempts:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCCUCAAAAGGAGGAAACCUCUACACAUGAGGAUCACCCAUGUGAAGGUGAAAAUCUCAAAUGGGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCCUCUAAAAGAGGAAACCUUUAAACAUGAGGAUCACCCAUGUGAGGAUGAAACCCUCUAAUGGGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

I suspect it will be possible, but what would be helpful for more axis symmetry switches to happen is if the repeat sequences are of a more cleaner anagram nature. That way a switch will become easier, even with more switching elements.

So more anagramic switch elements wanted! :slight_smile:

Thanks !  Nando thinks he has the issue identified.  He wrote

I think I know what’s going on: for OpenTB, we introduced a new feature for faster browsing, a server-side folding cache. Given that NuPACK was the only engine available, results were consistent. Now however, we’re using 3 engines, and players browsing designs with different engines are “polluting” the server-side cache by submitting folding information with a different engine than the one that was used to create the designs.

I need a bit of time to find a proper fix. It’s late here, but I’ll work on it first thing tomorrow morning. @omei can you please inform the players to be a bit patient, I’ll have this problem fixed within 24 hours, thanks.

Omei, this is awesome news. :slight_smile: Please send a big thx on to Nando!

Thx Poll na gColm and MasterStormer - your specification images and discussion got me shooting mine also.

I need sleep also - now actually. :slight_smile:

Shared Experiments - Hypothesis Busters :slight_smile:

Last Riboswitch lab round (101) was a training round for doing experiments and joining them together by hashtags (#). We did so as individual players and smaller groups, but not so much as a community.

However if more players join the same #hashtag experiments - we have a far better shot at getting enough data to either confirm or bust a hypothesis.

As for inspiration I volunteer my own plan for experimentation this round. These are things I think of as worthy experiments. I leave it open for you to join or make a variant should you wish.

For details on experiments on the experiment list, see: Hashtag Experiments

There are many more interesting things to test. Please put up your own #hashtag experiments and describe them in the forum for others to join.  

Help each other test hypothesis - join each other’s experiments

Thx to Mat and Omei for discussion

20 Experiments worth doing

Example of experiment done with hashtags

Control group and group with the tested feature. The idea is to take a set of different designs eg Group 1 and then do a Group 2 with identical designs, except they have GU’s added. Perhaps even put Group 1 and Group 2 in the design description to distinguis that a set of designs belongs together. Or G1 and G2.

GU in the switching area

Group 1: Designs with no GU in the switching area #GU-

Group 2: Designs identical to group 1, but with added GU #GU+

Seriously Fun Experiments

  • #MirrorAptamer    
  • #DoubleAptamer
  • #TripleAptamer
  • #AroundMS2Mutations
  • #DoubleMS2
  • #3-way
  • #4-way
  • #BlueprintAddition

Exclusion Lab Experiments

  • Shared Turnoff Sequence
  • GU in the switching area
  • MS2 position in relation to aptamer

Same State Lab Experiments

  • MS2 position in relation to aptamer

General experiments for Exclusion and Same State Labs

  • Different length of the aptamer gate
  • Different number of static stems
  • Static Stem or no static stem
  • Long static stem - with or without GU
  • Alternative MS2
  • Mismatches around switching stems
  • Mismatches in hairpin loop in switching stem
  • Patterns for closing basepairs in the aptamers

Past forum posts on related labs

See past Riboswitch Forum posts for inspiration for experiments to do and hypothesis to test.

FMN/MS2 Riboswitch Structure discussion

Blueprint of the MS2 and FMN Riboswitch

Switch Scores for EteRNA Switch Puzzles

Round 98 NG Switches Lab Discussion

Round 97 Riboswitch Lab Discussion

The lab portion we are to solve are either in family with or identical to some of the labs discussed in these forum posts.

1 Like

CRISPR Experiment - Round 1

I have been wondering about something in relation to the CRISPR experiment. Turned out Omei had too. I hereby share our conversation from saturday, as I think this is something we all should know.

eli: By the way, there is one thing I don’t understand. We are switching on and off the riboswitch region that we add. But we are doing nothing to the CRISPR part. I mean is it expected that the conformational changes in the switch bubble are to effect the binding of the CRISPR thingy? I don’t see us switching on or off the CRISPR thingy by our riboswitch addition.

omei: Re the puzzles, I had that same question.

eli: It has been bugging me…

omei: It turns out the CRISPR guide RNA refers to the whole RNA, not just the part that binds to the DNA.

eli: Interesting - so the off switch of the riboswitch part could really end up turning the CRISPR on. :wink:
Perhaps even skewing of the switch bubble may turn out helpful - biggest possible move

omei: I think this first round of puzzles is about testing the experimental pipeline as much doing something that is clinically relevant by itself…

eli: Ok. From what I read in the lab description it seems it have been bugging the scientists too.

“We hope the resulting data will let us figure out detailed rules for maximally activating and shutting down CRISPR.”

So okay it isn’t some big flaw in the lab set up - which I was kind of worried about

omei: It’s planned, I think, but not I’m not clear on the full path.  Rhiju is talking about doing the
experiments in vivo, using cell sorting.  This would give us even more capacity than the array experiments.  View these labs as a first step, not the final result.

1 Like

I guess we are learning about what it will take to learn about how to have our RNA work with CRISPR. Thanks for this information!

“We hope the resulting data will let us figure out detailed rules for maximally activating and shutting down CRISPR.” This part of the message from them led mt to try and put more gc near the ms2 switching area thinking maybe to help keep it OFF until needed to switch on well maybe on to off now that I read this conversation.  I can go Back to the OFF lab I’m referring to and make a set of those types and a set of heavy gu and a set of a balance of both. Thanks!

@Eli Nando has now fixed the issue that we think was causing your problem of the folding engines giving different predictions in different contexts.  Please repost if you still see something fishy.

This might already be known, I think I read this somewhere but now I cant find it…:
When I switch engines halfway through designing and then switch back  the undo stack is empty, this means I cant undo changes that made the design unstable… not very practical…